CN116143946A

CN116143946A - Novel fusion protein, gene, recombinant vector, host cell for immunotherapy and application

Info

Publication number: CN116143946A
Application number: CN202211654593.4A
Authority: CN
Inventors: 张毅; 梁悦; 古松海; 李峰; 刘婷怡; 闫忠辉; 张建; 胡文浩
Original assignee: Saidete Biopharmaceutical Co ltd
Current assignee: Saidete Biopharmaceutical Co ltd
Priority date: 2022-01-05
Filing date: 2022-12-22
Publication date: 2023-05-23

Abstract

The invention provides a novel fusion protein, a gene, a recombinant vector, a host cell and application for immunotherapy. The fusion protein provided by the invention is in a form of connecting an IL-23P40 subunit fragment and an immune checkpoint PD-1 fragment through a linker. The amino acid sequence of the fusion protein is shown as SEQ ID NO. 1 or SEQ ID NO. 3. The novel fusion protein for immunotherapy is constructed by combining cytokine IL-23P40 subunit with immune checkpoint PD-1 blocking; the P19 subunit in the activated T cells is highly expressed, and the P40 subunit of the fusion protein can form IL-23 with the P19 subunit, so that the function of the T cells is enhanced, and the anti-tumor performance of the T cells is improved by combining with anti-PD-L1.

Description

Novel fusion protein, gene, recombinant vector, host cell for immunotherapy and application

Technical Field

The invention belongs to the field of fusion proteins, and in particular relates to a novel fusion protein for immunotherapy, a gene, a recombinant vector, a host cell and application.

Background

Cytokines have a wide range of antitumor activities, and a variety of cytokines have been used in cancer therapy. There are several cytokine drugs available on the market approved by the FDA, such as high doses of IL-2 for the treatment of melanoma and renal cell carcinoma, IFN- α for adjuvant treatment of stage III melanoma. Still more cytokines have entered clinical trial stages such as GM-CSF, IL-7, IL-12, IL-15, IL-18, IL-2, and the like.

Immune checkpoints refer to some inhibitory signaling pathways present in the immune system, where the co-stimulatory and co-inhibitory signals remain balanced under normal anti-tumor immune response conditions, and maintain immune tolerance by modulating the intensity of the autoimmune response. When the organism is affected by tumor, the organism can block the signal channel of the immune check point, thereby inhibiting autoimmunity, and providing opportunities for the growth and escape of tumor cells. How to determine effective targets in each passage and develop corresponding anti-tumor drugs becomes an important task and direction of tumor treatment in recent years.

PD-1 is a member of the CD28 family, expressed on the surface of activated T cells, and functions to inhibit the T cell response by binding to the ligand PD-L1, preventing tissue damage caused by the T cell excessive response, and is a negative regulatory mechanism for normal T cell response. The tumor cells are combined with PD-1 on the surface of the T cells through high expression of PD-L1, so that the tumor cells can inhibit the anti-tumor T cells from killing the tumor cells, and the tumor cells are an important mechanism for tumor immune escape. Scientists invent an anti-PD-1 antibody, which can block the combination of PD-L1 on the surface of tumor cells and PD-1 receptor on the surface of T lymphocytes, relieve the inhibition of the tumor cells on the T lymphocytes, and the T lymphocytes with recovered functions can kill the tumor cells and clear in-vivo tumors, thus being a tumor therapeutic agent-anti-PD-1 antibody which is widely focused internationally at present.

The invention patent application with international publication number of WO 2021/092719A1 relates to a fusion protein for inducing differentiation of target antigen-specific T cells into memory stem cells, which belongs to an anti-PD-1 antibody and IL-21 fusion protein, can block the combination of PD-L1 and the PD-1 on the surface of the T cells, exert the tumor treatment effect of the anti-PD-1 antibody, target IL-21 to the tumor-specific T cells, induce the differentiation of the T cells, regulate the functions of the T cells, and further improve the tumor treatment effect of the PD-1 antibody. The above patents are further focused on the use of fusion proteins of cytokines of monomeric or homodimeric proteins in combination with immune checkpoints, which initiate lack of regulation and selectivity, possibly causing significant toxicity.

Disclosure of Invention

The invention aims to provide a novel fusion protein for immunotherapy, which has good anti-tumor performance, has starting selectivity and ensures safety.

A second object of the present invention is to provide a gene encoding the above fusion protein.

A third object of the present invention is to provide a recombinant vector comprising the above gene.

A fourth object of the present invention is to provide a host cell into which the above gene or recombinant vector is introduced.

A fifth object of the present invention is to provide the use of the above fusion protein, recombinant vector or host cell for preparing antitumor drugs.

In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:

the invention provides a fusion protein which is formed by connecting an IL-23P40 subunit fragment and an immune checkpoint PD-1 fragment through a connector.

Preferably, the amino acid sequence of the IL-23P40 subunit fragment is shown in positions 1-328 of SEQ ID NO. 1; the amino acid sequence of the PD-1 fragment is shown in 342-488 th position of SEQ ID NO. 1;

preferably, the linker is Pro-rich linker or GS linker;

more preferably, the amino acid sequence of the fusion protein comprises:

a. an amino acid sequence shown as SEQ ID NO. 1 or SEQ ID NO. 3; or alternatively

b. A modified amino acid sequence obtained by hydroxylation, carboxylation, carbonylation, methylation, acetylation, phosphorylation, esterification and/or glycosylation modification on a side chain group, amino terminal or carboxyl terminal of the amino acid sequence shown in SEQ ID NO. 1 or SEQ ID NO. 3.

The novel fusion protein for immunotherapy is constructed by combining cytokine IL-23P40 subunit with immune checkpoint PD-1 blocking; the P19 subunit in the activated T cells is highly expressed, and the P40 subunit of the fusion protein can form IL-23 with the P19 subunit, so that the function of the T cells is enhanced, and the anti-tumor performance of the T cells is improved by combining with anti-PD-L1.

Interleukin-23 (IL-23) is a newly discovered hematopoietic cytokine of heterodimeric structure in 2000, consisting of two subunits, P40 and P19, structurally sharing the P40 subunit with IL-12.

Unlike existing immune checkpoints, which form fusion proteins with cytokines, the cytokine moiety is typically monomeric or homodimeric, and its function is not selective. In the invention, the fusion protein can form complete cytokines and perform functions only after up-regulation of another subunit (P19 subunit, common activated T cells), has function selectivity, reduces T cell overreaction and ensures safety.

In addition, the invention also carries out optimization selection on the linker of the fusion protein so as to enhance the application effect. Specifically, the Pro-rich linker used in SEQ ID NO. 1 has better application effect than the GS linker used in SEQ ID NO. 3.

The invention also provides a gene for encoding the fusion protein, and the fusion protein is encoded by using the gene.

Preferably, the gene encoding the fusion protein shown as SEQ ID NO. 1 is shown as SEQ ID NO. 2; the gene for encoding the fusion protein shown as SEQ ID NO. 3 is shown as SEQ ID NO. 4. The fusion protein can be conveniently and effectively obtained by using the coding gene or used for transformation of T cells.

The invention also provides a recombinant vector containing the gene. The recombinant vector can be used for realizing the production of fusion proteins or the transformation of T cells.

Mammalian cell systems can be constructed using recombinant vectors to facilitate and efficiently achieve production of fusion proteins.

Preferably, the recombinant vector is a lentiviral expression vector, and the CAR-T cells can be conveniently manufactured by adopting the form of the lentiviral expression vector.

Further preferably, the lentiviral expression vector contains a CAR276-BBz fragment or a CARmeso-BBZ fragment, and the nucleotide sequence of the CAR276-BBz fragment is shown as SEQ ID NO. 7; the nucleotide sequence of the CARmeso-BBz fragment is shown in SEQ ID NO. 12. The lentivirus expression vector has strong targeting ability to tumors and good effectiveness.

The present invention also provides a host cell into which the above gene, or the above recombinant vector, is introduced.

The host cell can enhance T cell function, and can be used for tumor treatment. Preferably, the host cell is a T cell or CAR-T cell.

The invention also provides application of the fusion protein, the recombinant vector or the host cell in preparing one or more of the following preparations:

antitumor drugs;

an immunotherapeutic agent; and/or

A formulation that promotes T cell function.

Preferably, the tumor is lung cancer or esophageal cancer. Experiments prove that the medicine has better killing ability on lung cancer or esophageal cancer cells, so that the medicine can be used for the immunotherapy of tumors in the field and has good application prospect on the treatment of solid tumors.

Drawings

FIG. 1 shows the effect of different transient supernatants on functional markers on T cells according to the invention;

FIG. 2 shows the effect of different linker on the functional activity of fusion proteins according to the present invention;

FIG. 3 shows the effect of different treatments on T cell function in the presence or absence of PD-L1Fc fragment according to the present invention;

FIG. 4 shows the effect of different treatments on T cell proliferation in the presence or absence of PD-L1Fc fragments according to the present invention;

FIG. 5 is a graph showing the killing effect of different CAR-T cells on H322 lung cancer cell line and KYSE150 esophageal cancer cell line;

FIG. 6 is a graph of the results of the detection of cytokines by different CAR-T cell assays;

FIG. 7 shows the in vivo experimental effect of different CAR-T cells;

figure 8 is the inhibitory effect of different CAR-T cells on tumors.

Detailed Description

In the invention, the subunits of the cytokines consisting of the heterodimers are selected as part of the fusion protein, and one subunit can form natural cytokines and has stronger functions. And has another subunit limitation, so that the fusion protein plays a role and is closely related with T cells, and obvious toxicity is avoided.

The following describes the practice of the invention in detail with reference to specific examples. The main materials and reagents involved in the following examples and experimental examples are described below:

peripheral blood of healthy people comes from blood center of red cross in Henan province;

lung cancer cell line H322 and human embryonic kidney cells 293T, hela cell line, KYSE150 cell line, 293T cell line, purchased from the national academy of sciences Shanghai cell bank;

competent E.coli DH 5. Alpha. And competent E.coli Tstbl3, purchased from Beijing, pharmacology, inc.; DMEM high sugar medium, RPIM1640 medium, PBS buffer, protease inhibitor, phosphatase inhibitor DMSO (dimethyl sulfoxide), PMSF (phenylmethylsulfonyl fluoride), etc., all manufactured by Sigma company in the united states;

Opti-MEM medium, fetal bovine serum, etc., available from Gibco corporation, U.S.A.;

x-vivo15 medium, product of LONZA biotechnology company, switzerland;

human peripheral blood lymphocyte separation liquid, tianjin, a product of the biological technology limited company of the family of the ocean, the third party;

human CD8 microbeds, human CD3 microbeds, MACS buffer, T cell TransAct T cell activation beads, magnetic separation LS column, product of the Germany Meitian-Width company;

RIPA lysate, shanghai bi yunshan biotechnology limited company product;

RNAiso Plus, a product of Thermo Inc., USA;

reverse transcription kit, gt-551 medium, ecoRI restriction endonuclease, bamHI restriction endonuclease, product of Japan Bao Ri Biotechnology Co., ltd;

immunohistochemical kit, the product of the biological technology limited company of the golden bridge of the fir in Beijing;

protein electrophoresis gel kit, beijing daceae is a product of biotechnology limited company;

one-step directed cloning kit, a product of Shanghai offshore science and technology Co., ltd;

DNA gel recovery kit, axygen company, USA;

ELISA kit, hangzhou Union biotechnology Co., ltd;

calcium transfer kit (CalPhos) ^TM Mammalian Transfection Kit User Manual) Takara Corp;

100 XGreen-streptomycin mixed solution, trypsin powder, 0.25% trypsin digestion solution, 0.05% trypsin digestion solution, 20 XTBST, 50 XTAE buffer solution and the like are all products of Beijing Soy Bao technology Co., ltd;

recombinant human IL-2, CD28 mab, CD3 mab, annexin V binding buffer, 10x breaker, PE-Anti-human CD69, APC-CY7 Anti-human CD8, APC Anti-human Ki67, APC-A700Anti-human TNF-A, percp Anti-human GranzmeB, FITC Anti-human IFN-G, APC Anti-human IL-2, APC-A700Anti-human Perforin, PE-Anti-human CD137 (4-1 BB), PE-CY7-Anti-human IFN-gammSub>A, APC-Anti-human CD107 Sub>A, APC-CY7-Anti-human CD25, APC-CY7-Anti-human CD4RO C-ti-human CCR7, AF 700-Anti-human/GranzmeB, and the like, all being products from American company;

peprotech recombinant human IL-23 2 μg package;

recombinant Fc fragment of PD-L1, yiqiaoshenzhou;

SYBER Green fluorescent quantitative premix, australian BCS company product;

NC film, product of GE company, USA;

PE anti-PLPP1, wohaboutsche Biotechnology Co., ltd;

10% FBS-DMEM high sugar complete medium, 10% FBS-RPIM1640 complete medium, cell cryopreservation solution, protein lysate, electrophoresis solution, transfer membrane solution, 1 XTBE buffer solution, western blocking solution, 5% BSA solution, etc., and is prepared conventionally according to the prior art. Flow buffer containing 2% serum, conventionally configured with PBS;

main instrument equipment:

PCR instrument, gel imaging system, product of Bio-Rad company, USA;

DxFLEX flow analysis system, moflo-XDP high-speed flow separation system, product of Beckmann Kort company, U.S.A.;

IVIS in vivo imaging system, perkinElmer company, usa;

miltenyi magnetic sorting magnetic field, product of Miltenyi, miltering, germany.

Example 1 fusion protein, coding Gene

The amino acid sequence of the novel fusion protein for immunotherapy of the embodiment is shown in SEQ ID NO:1, the connecting peptide is Pro-rich linker, and the amino acid sequence is papap. The nucleotide sequence of the gene for encoding the fusion protein is shown as SEQ ID NO. 2.

Example 2 fusion proteins, coding genes

The amino acid sequence of the novel fusion protein for immunotherapy of the embodiment is shown in SEQ ID NO:3, wherein the connecting peptide is GS linker, and the amino acid sequence is ggggsgggs. The nucleotide sequence of the gene for encoding the fusion protein is shown as SEQ ID NO: 4.

Example 3 method for obtaining recombinant vector and fusion protein

The recombinant vector of this example cloned the gene with the sequence shown in SEQ ID No. 2 into a mammalian expression vector.

3.1 the construction method of the recombinant vector (fp 40 plasmid) is as follows:

firstly, inquiring the gene sequence of the human IL-23P40 subunit from NCBI website, selecting proline-rich linker PAAP to connect protein domains according to the high affinity sequence of mutant PD-1, and adding start and stop codons to obtain the sequence.

Then cloning on mammal expression vector pcDNA3.1 (-), selecting enzyme cutting site as XhoI/EcoRI based on the requirement of subsequent experiment, converting the above connection product into Stabl3 competent cells, culturing overnight, selecting single colony for sequencing verification, selecting strain with correct sequence, extracting plasmid after expanding culture, or freezing for later use.

3.2 the method for obtaining the fusion protein comprises the following steps: 293T cells were transfected with the expression vectors of this example for protein expression and purification. The method comprises the following specific steps:

(1) Passage of 293T

Culturing and passaging 293T cells: TC flasks (Nest blue cap) and complete medium were used; the culture medium is restored to room temperature before being used; during the culture process, the 293T cells are not overgrown (the cell fusion degree is too high or the cells grow in a lump), otherwise, transfection is affected; digestion and passage are carried out when the cell fusion degree is 60% -80%; digestion was performed using 0.05% pancreatin (Gibco); according to the cell fusion degree, 1:3-1:5 passages are carried out, the residual cells are not too small, otherwise, the cell state is influenced; during the culture process, the cell state is observed (the cell growth is vigorous, the morphology is stretched, and the state can be considered as good); cell wall detachment is avoided during operation.

(2) Transient transformation of plasmid

Cell plating: according to the cell state, 293T cells are inoculated into a 6-well plate (Nest) 18-24h in advance (the cell fusion rate is ensured to reach about 60% during transfection), and each well of cells is paved with 6 multiplied by 10 ⁵ Cell amount, 3ml DMEM medium containing 10% serum per dish, two six well plates were plated in total; when plating, attention is paid to whether the incubator is horizontally placed, and if the incubator is not horizontally placed, uneven cell growth can be caused to influence virus production; the movement of cells or the forced opening and closing of the incubator are avoided as much as possible within 6 hours after plating;

cell exchange liquid: the cells are observed in the morning of the next day, if the cell state is good, the growth is uniform, and the fusion degree is between 60 and 70 percent, the cells are replaced by a transfection medium (the old medium is sucked away as completely as possible), otherwise, the cells are allowed to grow for a period of time; transfection medium (DMEM-High Glucose medium (Sigma), containing 5% -10% FBS and 25. Mu.M chloroquine diphosphate (MCE)) was added, 2ml per dish;

transfection: after 2h of replacement of the transfection medium, preparing transfection; the transfection reagent is restored to room temperature before use; preparing solution A: (1.5. Mu.g plasmid, 12.4. Mu.l 2)M CaCl ₂ Sterile water was supplemented to 100. Mu.l) and solution B (2X HEPES) 100. Mu.l; adding the solution B into the solution A, uniformly mixing, and incubating at 22 ℃ for 15min; after being gently blown and evenly mixed, the mixture is evenly added to the liquid surface of the cell to be transfected (without contacting the cell); after addition to the cells, the formation of a precipitate was confirmed under a microscope; the operation is rapid, so that the cells are prevented from staying at room temperature for too long;

end of transfection: after transfection for 6h, the medium was changed; gently sucking out the supernatant, carefully adding a complete culture medium to avoid cell wall detachment; the complete culture medium is recovered to room temperature and then is used; the operation is rapid, so that the cells are prevented from staying at room temperature for too long;

after the end of the transfection liquid for 24 hours, the transfection supernatant (containing fusion protein) is collected, centrifuged for 10min at 2000r to remove cell debris, and stored at 4 ℃ for co-incubation experiment for later use.

Protein purification:

1. expression of the plasmid: expression was performed in a CHO eukaryotic expression system using P19-His and P40-PD-1-Flag (fP 40) on the pcDNA3.1 (-) vector, as in conventional procedures. CHO cells at a temperature of 37 ℃, CO ₂ Culturing in an incubator with a concentration of 8%. 1 day prior to transfection, cells were plated at the appropriate density. On the day of transfection, the state of the cells is observed, and the DNA is mixed with the transfection reagent in the optimal ratio and added to the dishes ready to transfect the cells. The recombinant plasmid encoding the protein of interest was transiently transfected into 30ml of suspension containing CHO cells. Cell density and viability were measured 5, 7, 9 days after transfection. Cell culture supernatants at days 5, 7, and 9 post-transfection were taken to verify protein expression.

2. Protein expression analysis and purification: cell culture supernatants at day 5, day 7, and day 9 after transfection were collected and analyzed for protein expression by SDS-PAGE and Western blot. Cell culture supernatants were collected for protein purification on day 10 post-transfection. Filtering the concentrated supernatant at a rate of 2ml/min with 0.2 μm membrane, and loading onto a column ^TM FF, then washed and eluted with the appropriate buffer. The peak levels were mixed together and the sample buffer was exchanged into PBS (pH 7.2). Gel filtration label of Bio-Rad used in this purificationThe standard is a lyophilized mixture of molecular weight markers ranging from 1350KD to 67 KD. It is a calibration standard for gel filtration/Size Exclusion Chromatography (SEC) columns used for protein purification and analysis under non-denaturing conditions, suitable for exclusion of gels limited to about 60,000 to 5,000,000 daltons. This mixture contains thyroglobulin, gamma globulin, ovalbumin, myoglobin and vitamin B12. Both vitamin B12 and myoglobin are visible when applied to the column, ensuring that the column is properly packed and the sample is eluted uniformly.

Example 4 use of fusion proteins to promote T cell function

In this example, the fusion protein was tested for promoting T cell function, and the procedure for the related versatility experiment was outlined below;

(1) Peripheral blood mononuclear cell isolation

Taking 10ml of peripheral blood, centrifuging at 22 ℃ for 5min, sucking plasma (or preserving at-80 ℃ for standby), and diluting with PBS (phosphate buffer solution) with 1 time of volume for standby;

taking a 50ml centrifuge tube, adding 20ml lymphocyte separation liquid, uniformly blowing the diluted peripheral blood, and lightly adding the peripheral blood into the upper layer of the lymphocyte separation liquid;

centrifuging at 22deg.C for 25min at 1100g, carefully sucking lymphocyte layer after centrifugation, adding PBS (of the same volume as that of the sucked lymphocyte layer), centrifuging at 1800rpm for 5min to clean cells; the supernatant was discarded again, and 5ml of PBS was added again to wash the cells once, and the PBS was discarded by centrifugation, and the obtained pellet was peripheral blood mononuclear cells.

(2) Activation of CD3 ⁺ T cell sorting

Peripheral blood mononuclear cells (or tumor tissue single cell suspension), 500g were centrifuged for 5min, followed by resuspension of the cells with 3ml of MACs (Magnetically activated cell sorting) buffer, 500g were centrifuged for 5min; cells were again reselected with 3ml MACs buffer and counted;

every 1×10 ⁷ Adding 10 μl of human CD3 magnetic beads and 40 μl of MACs buffer into the cells, mixing by vortex, incubating at 4deg.C in dark for 15min, and mixing every 3 min;

after the last mixing, placing the MS magnetic separation column in a corresponding magnetic field, and adding 1ml of MACs buffer solution to rinse the column; after the incubation operation is finished, adding all cells into a magnetic separation column, adding 1ml of MACs buffer solution to wash after the cells completely pass through the column so as to remove unbound cells, and repeating the steps twice;

after the liquid completely passes through the column, adding 3ml of MACs buffer solution, taking out the column from the magnetic field, and rapidly pumping the cells into a sterile centrifuge tube by using a piston; after cell counting, 500g was centrifuged for 5min and the liquid was discarded, and the plate was resuspended in RPIM1640 medium containing IL-2, 3-5X 10 per well ⁷ Cell mass.

(3) T cell culture

Human CD3 ⁺ T cell lines were cultured in RPIM1640 medium containing 10% FBS+1% of the mixture of green-streptomycin and 200IU IL-2, and when cultured, the T cell lines were passaged by half-changing every other day:

restoring the culture medium to room temperature in an ultra clean bench;

gently sucking the upper culture medium, and adhering to the wall to avoid sucking out cells;

1-2ml of fresh RPIM1640 medium containing 200IU IL-2 is added, and the mixture is gently stirred and mixed.

4.1 test for promoting T cell function

Following transient transformation using the different plasmid reference example 3, transient supernatant containing fusion protein was used to transiently react with semi-activated CD3 ⁺ T cells are incubated together, and CD3/CD28 monoclonal antibody stimulation is carried out, and functional markers such as CD25, CD137, CD107a and the like are detected by cell recovery flow. The specific operation is as follows:

CD3 selected ⁺ T cell re-counting plate (1 12 well plate), 1X 10 per well ⁶ Cell mass, resuspended in 0.5ml RPIM1640 and added to each set of transfection supernatants stored at 4℃2ml per well, 3 wells per cotransfer supernatant, 5. Mu.l T cell activation beads per well in 5% CO ₂ Culturing in an incubator at 37 ℃ for 24 hours;

after 24h incubation in incubator, 1800r of harvested cells were centrifuged for 5min, the culture supernatant was discarded, washed twice with PBS containing 2% FBS, the stained antibody was resuspended with 50. Mu.l of system, incubated on ice for 30min in the dark, washed once with flow buffer after completion of centrifugation and resuspended with 200. Mu.l of flow buffer, and run on machine.

The effect of each treatment group on T cell function markers is shown in figure 1. In fig. 1, the experimental grouping cases are: empty vector transfection (vector); P19-His plasmid transfection (P19 subunit is one of the IL-23 other subunits); fP40-FLAG plasmid transfection (fP 40 plasmid of example 3, panel P40-FLAG in FIG. 1); IL-23-PD-1 group (example 3 fP40 plasmid, P19-His plasmid cotransfection, molar ratio of 1:1).

During construction of the P19-His vector, the gene and protein sequence of the human IL-23P19 subunit are queried from NCBI website, and a common protein tag His-tag is added to synthesize a gene fragment of the P19-His in order to facilitate detection of protein expression. The nucleotide sequence of the P19-His is shown in SEQ ID NO. 5. The pcDNA3.1 (-) was selected as the initial vector, and the specific construction method can be referred to the above examples or related prior art.

As can be seen from fig. 1, the fusion proteins in the cell transfection supernatants have a promoting effect on the function of T cells, and the T cell function of the fusion protein group is significantly enhanced compared to other control groups and is limited to the time when complete IL-23 cytokines are formed.

4.2 different linker comparative experiments

Isolation and activation of CD3 by peripheral blood mononuclear cells ⁺ T cell sorting, T cell culture, 293T passaging, plasmid transient, fusion protein-containing supernatant co-incubated with T cells and detection of T cell function markers, and the like are referenced in section 4.1.

An fP40-GS linker plasmid was prepared by the method of reference example 3, and the fusion protein connecting peptide was GS linker.

Following transient transformation using the different plasmid reference example 3, transient supernatant containing fusion protein was used to transiently react with semi-activated CD3 ⁺ T cells are incubated together, and functional markers such as CD137, CD69, CD107a and the like are detected by cell collecting flow.

The effect of different markers on T cell function markers is shown in figure 2.

In fig. 2, the experimental grouping cases are: GS linker group (fP 40-GS linker plasmid and P19-His plasmid co-transfected in a molar ratio of 1:1), pro-rich linker group (fP 40-pro-rich linker plasmid and P19-His plasmid co-transfected in a molar ratio of 1:1).

As can be seen from FIG. 2, the example uses a Pro-rich linker to enhance the functional activity of the fusion protein compared to the control group using the GS linker.

Example 5 recombinant vector (lentiviral expression plasmid), host cell (CAR-T cell)

The recombinant vector of this example contains the nucleotide sequence shown as SEQ ID NO. 6, which includes the CAR276-BBz fragment (nucleotide sequence shown as SEQ ID NO. 7), the P2A sequence (nucleotide sequence shown as SEQ ID NO. 8) and the fp-40 encoding gene (nucleotide sequence shown as SEQ ID NO. 2; PAPAPAP linker).

5.1 the construction method of lentiviral expression plasmid is as follows:

first, the fP40 fusion protein sequence was amplified using the recombinant plasmid containing the fusion protein sequence of example 3 (fP 40 plasmid) as a template, and the primer sequences for PCR amplification were designed as follows:

f is tggaggagaaccctggacctatgtgccaccagcagctg, which is shown as SEQ ID NO. 9.

R is atccagaggttgattgtcgactagaacagatcgctagggtcc and is shown as SEQ ID NO. 10.

And (3) carrying out PCR amplification by using the primers, and carrying out electrophoresis and recovery on PCR amplification products to obtain fragments of about 600bp.

Then, the existing pCDH-EF1-myc-8H9S33 (CD 276) -BBz vector is subjected to double digestion of XhoI/EcoRI, and a lentiviral plasmid containing fusion protein is constructed for obtaining the digested vector fragment (the coding gene of the vector fragment of CAR276-BBz is shown as SEQ ID NO: 7).

And then, connecting the fusion protein fragment obtained by cloning with the linearized pCDH-EF1-myc-8H9S33 (CD 276) -BBz subjected to double digestion by using a NovoRec one-step PCR cloning kit, transforming the connection product into a Stabl3 competent cell, screening, sequencing, ensuring correct recombination (namely the fP40 fusion protein lentiviral plasmid), and extracting the plasmid from the strain with correct sequencing or freezing for later use.

5.2 construction of host cells (CAR-T cells) the following procedure was followed:

first, when lentivirus packaging is performed: 293T cells in good growth status were plated in 10cm cell culture dishes, 6X 10 per dish ⁶ Culturing and adhering overnight; the cells are observed in the next day, and if the cell state is good, the growth is uniform and the fusion degree is 80% -90%, the cells are replaced by a transfection medium containing 25uM chloroquine phosphate (the old medium is sucked away as completely as possible);

in a 15ml centrifuge tube, sterile water and 10. Mu.g of the master plasmid (fP 40 fusion protein lentiviral plasmid), 6.25. Mu.g of the packaging plasmid PsPAX2, 1.875. Mu.g of the packaging plasmid pMD2.G,2M CaCl were added ₂ 145 μl, a total of 1170 μl system; adding 1170 μl of 2M HEPES after mixing, slightly blowing, and incubating at 22deg.C for 15min;

dropwise adding the transfection system into the 293T cells, and continuously culturing for 6 hours; fresh DMEM medium containing 10% FBS is replaced, and culture is continued for 48 hours; centrifuging at 16deg.C and 3000rpm for 10min to remove cell debris, and collecting supernatant to obtain packaged lentivirus.

Subsequently, T cell infection was performed using the lentiviruses described above to prepare CAR-T cells, specific procedures:

taking CD3 from peripheral blood of healthy person ⁺ T cells, resuspended to 3X 10 with T cell Medium ⁶ /ml；

Every 1×10 ⁶ 10. Mu.l of CD3 CD28 activation beads were added, mixed and plated into 12-well cell culture plates, 2ml per well;

collecting T cells after 48h, centrifuging at 1500rpm for 5min, and discarding the supernatant; cells were resuspended in fresh 1640 medium and counted;

centrifuging 500g of the obtained cells for 5min, and re-suspending to 2×10 ⁶ Per ml, 0.5ml per well, plated into 12-well plates;

2ml of the viral supernatant (the supernatant prepared after packaging of the aforementioned viruses) and 0.6. Mu.g of polybrene auxiliary infectious agent were added; placing the 12-hole plate in a horizontal rotor centrifuge, centrifuging at 32 ℃ and 1000g at a speed of 9 to 5, and centrifuging for 1.5h;

after centrifugation, the medium was carefully discarded and 1ml of fresh T cell medium was added and this step was repeated once;

cells were placed in an incubator for continued culture, and after 72h the flow cytometer detected myc positive rate to determine the transfection efficiency of the CAR.

In the above examples, T cells were isolated and cultured using a universal experimental procedure, and reference was made to example 4. Plasmid transformation, plasmid extraction, etc. may be carried out by referring to the conventional procedures of the prior art, or may be specifically referred to as follows.

When the plasmid is transformed: after dissolving 100 μl of competent cells on ice, adding a connecting system (or plasmid 10 ng) into the competent cells, flicking for 2-3 times, mixing well, and incubating on ice for 30min; heat shock at 42 ℃ for 45s, and then placing on ice for 2min; 400 μl of LB medium without antibiotics is added, and the mixture is shaken at 37 ℃ and 200rpm for 30min; 100 μl of the bacterial liquid is smeared on an LB plate containing 200 μg/ml of ampicillin, and cultured overnight at 37 ℃; and further picking out positive single colony for amplification culture.

In the process of plasmid extraction, a small and medium-amount kit of the root plasmid is adopted for extraction, and the specification is referred to in the specific reference, or the following is referred to:

taking 15ml of bacterial liquid to be extracted, centrifuging at 3000rpm for 10min, discarding the culture medium, re-suspending the bacterial liquid with saline water, transferring the bacterial liquid into a 2ml centrifuge tube, centrifuging at 12000rmp for 3min, and discarding the supernatant;

add 500. Mu.l of reagent P1, vortex until the cells are fully suspended, mix well, then add 500. Mu.l of cell lysate P2. Gently mixing for 8 times by upside down, adding the reagent P4 500 μl, and immediately mixing;

standing at room temperature for 10min, and centrifuging at 12000rmp for 10min; adding the supernatant into an endotoxin removal filter column, and centrifuging; adding 0.3 times volume of isopropanol into the filtered liquid, mixing well, adding the liquid into a plasmid binding column (adding 500 μl of balance buffer into the plasmid binding column in advance, centrifuging at 12000rmp for 1min to activate the column), centrifuging at 12000rpm for 1min;

washing the column 1 time with 500. Mu.l of protein-removing liquid PD, washing the column 2 times with PW, and centrifuging at 12000rpm for 2min to remove the remaining liquid;

placing the plasmid binding column in a new 1.5ml centrifuge tube, adding 200 μl of sterile deionized water to the center of the DNA binding column, and standing at room temperature for 2min;

the plasmid was eluted by centrifugation at 12000rpm for 1min, and the plasmid concentration was measured.

On the basis of the present example, a fusion protein with a connecting peptide of GS linker (the nucleotide sequence is shown as SEQ ID NO: 4) can be constructed in the same manner.

Example 6 recombinant vector (lentiviral expression plasmid), host cell (CAR-T cell)

The recombinant vector of this example contains CARmeso-fP40-BBz, the nucleotide sequence of which is shown as SEQ ID NO. 11, and comprises a CARmeso-BBz fragment (the nucleotide sequence of which is shown as SEQ ID NO. 12), a P2A sequence (the nucleotide sequence of which is shown as SEQ ID NO. 8) and an fP-40 encoding gene (the nucleotide sequence of which is shown as SEQ ID NO. 2; PAPAPAP linker). Specific construction methods can be found in example 5.

Example 7 experiments on the influence of PD-L1 on T cell function in the Presence or absence

Given that the presence of PD-L1 affects the exertion of the cytokine IL-23 on T cell function, the effect of the comparative construct fusion protein fP40 (PAAP linker) on T cell function and proliferation in the presence or absence of PD-L1 was compared.

7.1 Effect on T cell function

The experimental method is as follows:

CD3 selected ⁺ T cell re-counting plate (2 12 well plates), 1X 10 per well ⁶ Cell mass, resuspended in 0.5ml RPIM1640 and 1.5ml of each set of transfection supernatant stored at 4℃per well, 3 wells per cotransfer supernatant, 5. Mu.l of T cell activation beads per well, BSA per set, commercial IL-23 recombinant protein (0.1. Mu.g), purified fP40 fusion protein (0.1. Mu.g; i.e. fIL-23 in FIG. 3) and haf-PD-1 protein (0.1. Mu.g) were added. Another 12 groups (for comparison, PD-L1 was present) were added with 0.5. Mu.g of PD-L1 recombinant protein at 5% CO ₂ Is cultured in an incubator at 37℃for 24 hours.

Wherein the nucleotide sequence of the Haf-PD-1 coding gene is shown as SEQ ID NO. 13. The Haf-PD-1 fragment was inserted into pcDNA3.1 (-) with NheI and BamHI cleavage sites, and the expression and purification were performed in CHO cell lines as described in the purification steps of the fP40 protein.

After culturing for 24 hours in an incubator, collecting cells, centrifuging for 5 minutes at 1800r, discarding culture medium supernatant, washing twice with PBS containing 2% FBS, centrifuging, re-suspending a dyed surface marker with a 50 μl system, incubating on ice for 30 minutes in dark, washing once with a flow buffer after the end, adding 400 μl of 4% paraformaldehyde fixing agent, and incubating on ice for 30 minutes in dark; after the completion, the membrane is centrifuged for 5min at 2000r, washed once by a flow buffer, added with 500 μl of 1 Xbreaker, incubated for 30min on ice in a dark place, 50 μl of breaker per tube after supernatant is discarded after centrifugation, and incubated for 30min on ice in a dark place, washed once by a flow buffer after completion, resuspended by 200 μl of flow buffer, and run on a machine.

The experimental results are shown in FIG. 3. As can be seen from FIG. 3, the fusion protein group still acts on T cells in the presence of the PD-L1Fc fragment in comparison with the cytokine control group, and the T cells of the corresponding experimental group function best.

7.2 Effect on T cell proliferation

CD3 selected ⁺ T cell re-counting plate (8 wells of 1 12 well plate), 2X 10 per well ⁶ Cell mass, re-suspension with 2ml RPIM1640, addition of 5. Mu.l T cell activation beads per well, addition of BSA according to groups, commercialization of IL-23 recombinant protein (0.1. Mu.g), purification of fP40 fusion protein (0.1. Mu.g), purification of haf-PD-1 protein (0.1. Mu.g), addition of 0.5. Mu.g of PD-L1 recombinant protein to 12 groups containing 5% CO ₂ In the incubator at 37℃of (C), 0Day, 2Day, 4Day, 6Day were cultured, and the results of the three counts under a microscope are shown in FIG. 4.

As can be seen from FIG. 4, the fusion protein group had the greatest number of T cells in the presence of the PD-L1Fc fragment in comparison to the cytokine control group.

Example 8 in vitro killing experiments of CAR-T cells

In vitro killing experiments were performed using the CAR-T cells prepared in the examples, the specific experimental conditions were outlined below:

taking H322 lung cancer cell line and KYSE150 esophageal cancer cell line (which are conventionally constructed and mainly used for visual observation) for respectively digesting and counting, taking appropriate amount of cells, respectively regulating cell concentration to 3×10 by using RPMI1640 culture medium ⁵ /ml；

Taking the prepared CAR-T cells, counted, plated 2X 10 wells per 96 well plate ⁴ Tumor cells and the effective target ratio is 1:1 and 1:5 plating CAR-T cells, 200 μl of medium per well of 96-well plate;

cells were incubated overnight in an incubator for 16h for luciferase analysis, 1 μl of diluted fluorescein was added to each well, and after 10min of reaction, tumor cell activity was detected with an IVIS imaging system to detect killing effect, and the results are shown in fig. 5.

The construction method of various CAR-T cells in FIG. 5 is as follows, fragments of P40, fP40 and haf-PD-1 are cloned from pcDNA3.1 (-) fP40-flag plasmid (PAAP linker) and pcDNA3.1 (-) haf-PD-1 plasmid respectively, and primers are designed when cloning the fragments as follows:

hafPD1-F tggaggagaaccctggacctgactacaaggatgacgatg as shown in SEQ ID NO. 14.

hafPD1-R atccagaggttgattgtcgactagaacagatcgctagg is shown in SEQ ID NO. 15.

P40-F tggaggagaaccctggacctatgtgccaccagcagctg is shown as SEQ ID NO. 16.

P40-R atccagaggttgattgtcgactacttatcatcgtcatccttgtagtcg is shown as SEQ ID NO. 17.

Fusion-F (fP 40-F): tggaggagaaccctggacctatgtgccaccagcagctg as shown in SEQ ID NO: 9.

Fusion-R (fP 40-R) atccagaggttgattgtcgactagaacagatcgctagggtcc as shown in SEQ ID NO. 10.

The cloned fragment was subjected to enzymatic ligation with the CAR276-BBZ plasmid to construct the corresponding CAR-T cell (see example 5 for details).

The results of the killing experiment are shown in fig. 5. As can be seen from fig. 5, the killing effect of the fusion protein on the modified CAR-T group is obviously enhanced under the condition of different effect target ratios at different time points in the two tumor cell lines.

Example 9 detection of CAR-T cell secreting cytokines

Using the CAR-T cells prepared in the examples, the inventors further performed detection of CAR-T cell secreting cytokines, as follows:

collecting the in-vitro killing supernatant of the embodiment 6, centrifuging, and storing in a refrigerator at-80 ℃ for later use;

1. before use, all the reagents are fully and evenly mixed, so that foam is avoided.

2. The number of strips required was determined based on the number of experimental wells (blank and standard), and both the sample (containing standard) and the blank should be multiplexed.

3. Sample adding: 100. Mu.l/well was added to diluted Cytokine standard to standard wells, 100. Mu.l/well was added to sample wells, and 100. Mu.l/well was added Dilution buffer R (1X) to blank wells.

4. Adding a detection antibody: 50 μl/well of Biotinylated antibody working fluid was added. After mixing, the mixture is covered with a sealing plate membrane and incubated for 1 hour at room temperature (18-25 ℃).

5. Washing the plate: the liquid in the hole is removed, and 300 mu l/well of 1 XWashing buffer working solution is added; after 1 minute of residence, the liquid in the wells was discarded. The procedure was repeated 3 times, each time with a filter paper for drying.

6. Adding enzyme: 100 μl/well was added with strepavidin-HRP working solution. The plate was covered and incubated at room temperature (18-25 ℃) for 20 minutes.

7. Washing the plate: and (5) repeating the step 5.

8. Color development: 100 μl/well TMB was added and incubated at room temperature (18-25deg.C) in the dark for 5-30 min, and termination was determined by the depth of color (dark blue) in the wells. Usually, the color development can be carried out for 10-20 minutes to achieve good effect.

9. Terminating the reaction: 100 μl/well was added rapidly to Stop the reaction.

10. Reading a plate: within 10 minutes after termination, the values were read at a detection wavelength (measurement wavelength) of 450 nm. It is recommended to read the plate simultaneously with two wavelengths, namely the detection wavelength (measurement wavelength) 450nm, the reference wavelength or the correction wavelength (reference wavelength) 610-630nm, and the measurement result will be more accurate.

FIG. 6 construction of individual CAR-T cells is described in example 8. As can be seen from fig. 6, the secretion capacity of the functional cytokine of CAR-T engineered with the fP40 fusion protein (PAPAP linker) was significantly enhanced.

Example 10 in vivo animal experiments

A living animal experiment was performed using severely immunodeficiency NOD-SCI mice (which were directly inoculated with a human tumor cell line and were tumorigenic), using the above-described CAR-T cells, and the detailed experimental procedure was outlined below.

NOD-SCID mice 5-6 weeks old (about 25 g) were inoculated subcutaneously 1X 10 on day 0 ⁶ Human esophageal cancer cell line KYSE150 (or Hela cells), after 7 days, tail vein is infused back 5×10 ⁶ CAR-T cells were treated, after which tumor size was measured every 3 days.

The change of the tumor size at different treatment times is shown in fig. 7, mice are sacrificed after ethical requirements are met, and the tumors are peeled off and are placed in order for photographing. The results are shown in FIG. 8. The cases of the groups Mock T, CAR meso, CAR PD-1, CAR P40, CAR fP40 are described as follows:

mock T is normal T cells that have not been transfected. The construction method of various CAR-T cells comprises cloning fragments of P40, fP40 and haf-PD-1 from pcDNA3.1 (-) fP40-flag plasmid and pcDNA3.1 (-) haf-PD-1 plasmid respectively, and designing primers when cloning the fragments as follows:

hafPD1-F tggaggagaaccctggacctgactacaaggatgacgatg as shown in SEQ ID NO. 14.

hafPD1-R atccagaggttgattgtcgactagaacagatcgctagg is shown in SEQ ID NO. 15.

P40-F tggaggagaaccctggacctatgtgccaccagcagctg is shown as SEQ ID NO. 16.

The cloned fragment was subjected to enzymatic ligation with the CARmeso-BBZ plasmid to construct the corresponding CAR-T cell (see examples 5 and 6 for details).

From the above results, it was found that in vivo experiments, the inhibition effect of the modified CAR-T with fP40 fusion protein (PAPAAP linker) on tumors was significantly improved.

Claims

1. A fusion protein comprising an IL-23P40 subunit fragment and an immune checkpoint PD-1 fragment linked by a linker.

2. The fusion protein of claim 1, wherein the amino acid sequence of the IL-23P40 subunit fragment is set forth in positions 1-328 of SEQ ID No. 1; the amino acid sequence of the PD-1 fragment is shown in 342-488 th position of SEQ ID NO. 1;

preferably, the linker is Pro-rich linker or GS linker;

more preferably, the amino acid sequence of the fusion protein comprises:

3. A gene encoding the fusion protein of claim 2;

preferably, the gene encoding the fusion protein shown as SEQ ID NO. 1 is shown as SEQ ID NO. 2; the gene for encoding the fusion protein shown as SEQ ID NO. 3 is shown as SEQ ID NO. 4.

4. A recombinant vector comprising the gene of claim 3.

5. The recombinant vector of claim 4, wherein the recombinant vector is a lentiviral expression vector.

6. The recombinant vector of claim 5, wherein the lentiviral expression vector comprises a fragment of CAR276-BBz or a fragment of CARmeso-BBZ, and wherein the nucleotide sequence of the fragment of CAR276-BBz is shown in SEQ ID NO. 7; the nucleotide sequence of the CARmeso-BBz fragment is shown in SEQ ID NO. 12.

7. A host cell into which the gene according to claim 3 or the recombinant vector according to any one of claims 4 to 6 has been introduced.

8. The host cell of claim 7, wherein the host cell is a T cell or a CAR-T cell.

9. Use of the fusion protein of claim 1 or 2, the gene of claim 3, the recombinant vector of any one of claims 4-6 or the host cell of claim 7 or 8 in the preparation of one or more of the following:

antitumor drugs;

an immunotherapeutic agent; and/or

A formulation that promotes T cell function.

10. The use of claim 9, wherein the tumor is lung cancer or esophageal cancer.