US5849686A - Morphogen-induced liver regeneration - Google Patents

Morphogen-induced liver regeneration Download PDF

Info

Publication number
US5849686A
US5849686A US08/445,468 US44546895A US5849686A US 5849686 A US5849686 A US 5849686A US 44546895 A US44546895 A US 44546895A US 5849686 A US5849686 A US 5849686A
Authority
US
United States
Prior art keywords
tissue
morphogen
xaa
res
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
US08/445,468
Inventor
Thangavel Kuberasampath
David C. Rueger
Hermann Oppermann
Roy H. L. Pang
Charles M. Cohen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
MARIEL THERAPEUTICS Inc
Original Assignee
Creative Biomolecules Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Creative Biomolecules Inc filed Critical Creative Biomolecules Inc
Priority to US08/445,468 priority Critical patent/US5849686A/en
Application granted granted Critical
Publication of US5849686A publication Critical patent/US5849686A/en
Assigned to CURIS, INC. reassignment CURIS, INC. MERGER (SEE DOCUMENT FOR DETAILS). Assignors: CREATIVE BIOMOLECULES, INC., ONTOGENY, INC., REPROGENESIS, INC.
Assigned to STRYKER CORPORATION reassignment STRYKER CORPORATION ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: CURIS, INC.
Assigned to MARIEL THERAPEUTICS, INC. reassignment MARIEL THERAPEUTICS, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: STRYKER CORPORATION
Anticipated expiration legal-status Critical
Assigned to MARIEL THERAPEUTICS, INC. reassignment MARIEL THERAPEUTICS, INC. LIEN (SEE DOCUMENT FOR DETAILS). Assignors: STRYKER CORPORATION
Assigned to MARIEL THERAPEUTICS, INC. reassignment MARIEL THERAPEUTICS, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: STRYKER CORPORATION
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/22Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against growth factors ; against growth regulators
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01NPRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N1/00Preservation of bodies of humans or animals, or parts thereof
    • A01N1/10Preservation of living parts
    • A01N1/12Chemical aspects of preservation
    • A01N1/122Preservation or perfusion media
    • A01N1/126Physiologically active agents, e.g. antioxidants or nutrients
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/18Growth factors; Growth regulators
    • A61K38/1875Bone morphogenic factor; Osteogenins; Osteogenic factor; Bone-inducing factor
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61LMETHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L27/00Materials for grafts or prostheses or for coating grafts or prostheses
    • A61L27/14Macromolecular materials
    • A61L27/22Polypeptides or derivatives thereof, e.g. degradation products
    • A61L27/227Other specific proteins or polypeptides not covered by A61L27/222, A61L27/225 or A61L27/24
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61LMETHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L27/00Materials for grafts or prostheses or for coating grafts or prostheses
    • A61L27/14Macromolecular materials
    • A61L27/22Polypeptides or derivatives thereof, e.g. degradation products
    • A61L27/24Collagen
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475Growth factors; Growth regulators
    • C07K14/51Bone morphogenetic factor; Osteogenins; Osteogenic factor; Bone-inducing factor
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61FFILTERS IMPLANTABLE INTO BLOOD VESSELS; PROSTHESES; DEVICES PROVIDING PATENCY TO, OR PREVENTING COLLAPSING OF, TUBULAR STRUCTURES OF THE BODY, e.g. STENTS; ORTHOPAEDIC, NURSING OR CONTRACEPTIVE DEVICES; FOMENTATION; TREATMENT OR PROTECTION OF EYES OR EARS; BANDAGES, DRESSINGS OR ABSORBENT PADS; FIRST-AID KITS
    • A61F2310/00Prostheses classified in A61F2/28 or A61F2/30 - A61F2/44 being constructed from or coated with a particular material
    • A61F2310/00005The prosthesis being constructed from a particular material
    • A61F2310/00365Proteins; Polypeptides; Degradation products thereof
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00Screening for compounds of potential therapeutic value
    • G01N2500/10Screening for compounds of potential therapeutic value involving cells

Definitions

  • the present invention relates generally to liver treatment methods.
  • the present invention relates to methods and compositions for regenerating lost or damaged liver tissue in vivo and to methods and compositions for maintaining normal liver function which may be reduced or lost as a result of such tissue damage.
  • the invention further relates to methods and compositions for correcting one or more liver function deficiencies in a mammal, particularly a human.
  • the liver is the largest visceral organ in the body and consists of two main lobes, a larger right lobe and a smaller left lobe.
  • the right lobe also contains two smaller segments referred to as the cuadata and quadrata lobes.
  • the liver has a dual blood supply, consisting of the hepatic artery and the portal vein.
  • the hepatic lymphatics drain principally into lymph nodes of the porta hepatis and celiac axis.
  • the liver is responsible for a wide variety of functions, broadly characterized as metabolic, storage, synthetic, catabolic and excretory. Specifically, the liver is the central organ of glucose homeostasis, responsible for both storing excess blood glucose as glycogen and restoring blood glucose by glycogenolysis and gluconeogenesis and by converting free fatty acids to triglycerides and lipoproteins. The liver also stores triglycerides, iron, copper and lipid-soluble vitamins and synthesizes many of the binding proteins for iron, copper and Vitamin A.
  • liver excretes bile, which provides a repository for the products of hemecatabolism and also is vital for fat absorption in the small intestine.
  • liver function disorders whether resulting from a particular protein deficiency or from hepatic tissue damage and/or loss, has serious and far-reaching consequences.
  • reduced albumin levels in chronic liver disease contribute to the development of edema and ascites; liver failure also is characterized by severe and often life-threatening bleeding, due to the reduced production of essential blood clotting factors.
  • Hepatic failure also can induce neurological dysfunction, characterized broadly as hepatic encephalopathy, as well as associated renal failure, jaundice, pulmonary complications, and a host of disorders associated with hormonal imbalances.
  • the liver has a defined regenerative capacity following hepatic tissue damage or cell death.
  • hepatocytes do not proliferate actively following fetal and post natal liver growth, normally quiescent hepatocytes do divide in response to cell death or loss of liver tissue.
  • tissue damage is extensive and/or chronic, permanent tissue damage can result, reducing the organ's viability and functional capacity.
  • Permanent hepatic tissue damage typically is characterized by extensive necrosis and/or fibrogenesis or scarring (cirrhosis). Another source of nonreparative damage results from hepatic neoplasms and metastatic carcinomas.
  • hepatic failure ensues.
  • the etiology of hepatic failure may be metabolic (e.g., altered bilirubin metabolism or fatty acid storage), infectious (e.g., induced by viral hepatitis, hepatic schistomiasis, syphilis, or ascariaris), toxic (e.g., induced by ethanol, ammonia, phenol, and other environmental toxins, fatty acids, drugs and/or their metabolites), autoimmune, ischemic or nutritional (e.g., alcoholic liver disease).
  • metabolic e.g., altered bilirubin metabolism or fatty acid storage
  • infectious e.g., induced by viral hepatitis, hepatic schistomiasis, syphilis, or ascariaris
  • toxic e.g., induced by ethanol, ammonia, phenol, and other environmental toxins, fatty acids, drugs and/or their metabolites
  • autoimmune ischemic or
  • the tumor cells may be derived from hepatic tissue cells (as in hepatocellular carcinoma, bileduct carcinomas, hepatoblastomas or hemangiosarcoma) or may be derived from distant tissue as part of a metastatic cancer.
  • metastatic cancers are by far the most common malignant neoplasms of the liver, most notably derived from cancers of the gastrointestinal tract, breast and lung.
  • liver function arises from hepatic protein deficiencies, which may result from a genetic defect (so called "inborn errors of metabolism") or may be induced by, for example, a pharmaceutical, infectious agent byproduct, or the like.
  • hemophilia is believed to be associated with diminished Factor VIII production.
  • Wilson's disease a copper metabolism disorder, is associated with deficient ceruloplasmin production by the liver. Altered production of albumin in the liver affects bilirubin metabolism. Deficiency of ⁇ 1 -antitrypsin, also normally produced in the liver, can result in fatal neonatal hepatitis.
  • liver transplantation the only viable treatment for hepatic failure or for patients at risk for hepatic failure due to, for example, chronic acute hepatitis, biliary atresia, idiopathic cirrhosis, primary biliary cirrhosis, sclerosing cholangitis, inborn errors of metabolism or malignancy.
  • liver transplantation also is the only viable alternative for correcting significant liver function deficiencies that result from inborn errors of metabolism. Liver transplantation as a treatment method suffers from donor scarcity, particularly of pediatric livers, technical surgical complexity, postoperative complications including organ rejection, and continuing difficulties in maintaining organ viability throughout the transplant process.
  • the present invention provides methods and compositions for maintaining liver function in a mammal.
  • the invention provides means for correcting one or more liver function deficiencies in a mammal that may arise, for example, from an inborn metabolism defect, and means for regenerating lost or damaged hepatic tissue in a mammal, including means for protecting the tissue from damage thereto.
  • the invention also provides means for enhancing the viability of a hepatic tissue or organ to be transplanted and means for enhancing the integration of the transplanted tissue.
  • compositions of this invention include providing to hepatic cells a therapeutically effective concentration of a morphogenic protein ("morphogen", as defined herein) upon hepatocellular injury, or in anticipation of such injury, or following diagnosis of a liver function defect in a mammal, for a time and at a concentration sufficient to maintain or regain liver function in vivo.
  • morphogen a morphogenic protein
  • the invention features compositions and therapeutic treatment methods that include administering to a mammal a therapeutically effective amount of a morphogenic protein ("morphogen"), as defined herein, upon hepatocellular injury, or in anticipation of such injury, or following diagnosis of a liver function deficiency, for a time and at a concentration sufficient to maintain normal and/or to regain lost liver function in vivo, including regenerating lost or damaged hepatic tissue, and/or inhibiting additional damage thereto.
  • morphogens described herein also are capable of enhancing the level of a liver function which may be depressed as a result of a tissue injury or disease.
  • the invention features compositions and therapeutic treatment methods for maintaining liver function in a mammal in vivo which include administering to the mammal, upon hepatocellular injury or in anticipation of such injury, or following diagnosis of a liver function deficiency, a compound that stimulates in vivo a therapeutically effective concentration of an endogenous morphogen within the body of the mammal sufficient to increase or enhance the level of a depressed liver function, and/or to maintain normal and/or regain lost liver function, including regenerating damaged or lost hepatic tissue and/or inhibiting additional damage thereto.
  • morphogen-stimulating agents are understood to include substances which, when administered to a mammal, act on cells of tissue(s) or organ(s) that normally are responsible for, or capable of, producing a morphogen and/or secreting a morphogen, and which cause the endogenous level of the morphogen to be altered.
  • the agent may act, for example, by stimulating expression and/or secretion of an endogenous morphogen.
  • the methods and compositions disclosed herein can be used to advantage in the repair, regeneration, transplantation and/or function level enhancement of damaged or lost tissue such as, for example, damaged lung tissue resulting from emphysema, cirrhotic kidney or pancreatic tissue, damaged heart or blood vessel tissue, as may result from cardiomyopathies and/or atherothrombotic or cardioembolic strokes, damaged stomach tissue resulting from ulceric perforations or their repair, damaged neural tissue as may result from physical injury, degenerative diseases such as Alzheimer's disease or multiple sclerosis or strokes, and damaged dental and/or periodental tissue as may result from disease or mechanical injury.
  • damaged or lost tissue such as, for example, damaged lung tissue resulting from emphysema, cirrhotic kidney or pancreatic tissue, damaged heart or blood vessel tissue, as may result from cardiomyopathies and/or atherothrombotic or cardioembolic strokes, damaged stomach tissue resulting from ulceric perforations or their repair, damaged neural tissue as may result from physical injury
  • the methods and compositions also may be used to protect these tissues from anticipated injury, including unavoidably or deliberately induced injury, as may occur in a surgical or other clinical procedure.
  • tissue regenerative properties provided herein, the gene therapy and drug delivery protocols described herein may be used to particular advantage in pancreatic tissue, renal tissue and lung tissue contexts.
  • the expression “maintaining normal liver function” means both regaining or restoring liver function lost due to a hepatocellular injury or inborn metabolic defect, as well as protecting the hepatic tissue at risk of damage from hepatocellular injury.
  • “Depressed liver function” level refers to a diminished or deficient liver function as a result of a tissue injury or disease.
  • the expression “enhance viability of" transplant hepatic tissue or organ means protection from, reduction of and/or elimination of reduced or lost tissue or organ function as a result of tissue necrosis and/or fibrosis associated with transplantation, particularly immune response-mediated tissue necrosis and/or fibrosis.
  • “Alleviating” means protection from, reduction of and/or elimination of undesired tissue destruction, particularly immune response-mediated tissue destruction.
  • Transplanted living tissue includes both tissue grafts and cellular transplants, as in the case of transplanted isolated progenitor or stem cells, for example, which may be implanted alone or in association with a temporary scaffolding. Tissues may be autologous or allogenic tissue and/or synthetic tissue created, for example, by culturing hepatic cells in the presence of an artificial matrix.
  • “Morphogenically permissive environment” is understood to mean an environment competent to allow tissue morphogenesis to occur.
  • symptom alleviating cofactor refers to one or more pharmaceuticals which may be administered together with the therapeutic agents of this invention and which alleviate or mitigate one or more of the symptoms typically associated with liver tissue and/or liver function loss.
  • exemplary cofactors include antibiotics, antiseptics, non-steroidal anti-inflammatory agents, and the like.
  • the methods and compositions of this invention are useful in the replacement of diseased, damaged or lost hepatic tissue in a mammal, particularly when the damaged tissue interferes with normal tissue or organ function.
  • hepatic tissue has been lost, remaining hepatocytes are capable only of compensatory cell division to return the organ volume essentially to its original size.
  • this compensatory growth does not involve true morphogenisis, and the lost tissue is not itself regenerated. Rather, the intact lobe is capable only of tissue augmentation to compensate for the lost mass.
  • toxin-induced tissue damage involves morphogenesis, particularly the infiltration and proliferation of progenitor cells.
  • endogenous morphogen expression is enhanced following toxin-induced hepatic tissue damage, and not following partial hepatectomy.
  • the invention provides methods and compositions for regenerating lost or substantially irreparably damaged hepatic tissue.
  • the morphogen preferably is provided directly to the locus of tissue regeneration, e.g., by injection of the morphogen dispersed in a biocompatible, injectable solution, or by topical administration, as by painting or spraying a morphogen-containing solution on the tissue.
  • the locus has been surgically prepared by removing existing necrotic or cirrhotic tissue.
  • morphogen may be provided locally by means of an osmotic pump implanted in the peritoneal cavity.
  • At least one morphogen (OP-1, comprising e.g. Seq. ID No. 5) is known to be expressed by hepatic tissue during liver formation.
  • an agent capable of stimulating expression and/or secretion of an endogenous morphogen may be administered.
  • progenitor hepatocytic cells may be stimulated ex vivo by exposure to a morphogen or morphogen-stimulating agent, and the stimulated cells, now primed for proliferation and differentiation, then provided to the hepatic tissue locus.
  • a morphogen or a morphogen-stimulating agent also may be implanted with the cells.
  • a suitable local morphogen concentration may be maintained by means of, for example, an osmotic pump.
  • the existing tissue provides the necessary matrix requirements, providing a suitable substratum for the proliferating and differentiating cells in a morphogenically permissive environment, as well as providing the necessary signals for directing the tissue-specificity of the developing tissue.
  • the morphogens or progenitor cells stimulated by these morphogens
  • a tissue-specific locus e.g., by systemic injection or by implantation or injection at a tissue-specific locus, or by administration of an agent capable of stimulating morphogen expression in vivo
  • the existing tissue at that locus whether diseased or damaged, has the capacity of acting as a suitable matrix.
  • a formulated matrix may be externally provided together with the stimulated progenitor cells or morphogen, as may be necessary when the extent of injury sustained by the damaged tissue is large.
  • the matrix should be a biocompatible, suitably modified acellular matrix having dimensions such that it allows the influx, differentiation, and proliferation of migratory progenitor cells, and is capable of providing a morphogenically permissive environment (see infra).
  • Currently preferred matrices also are biodegradable.
  • the formulated matrix preferably is tissue-specific.
  • Formulated matrices may be generated from a fibrin clot or dehydrated organ-specific tissue, prepared for example, by treating the tissue with solvents to substantially remove the non-structural components from the tissue.
  • the matrix may be formulated synthetically using one or more biocompatible, preferably in vivo biodegradable, structural carrier materials such as collagen, laminin, and/or hyaluronic acid which also may be in association with suitable tissue-specific cell attachment factors.
  • Other biocompatible, in vivo biodegradable components including synthetic polymers, including polybutyric, polylactic, polyglycolic acids, polyanhydrides and/or copolymers thereof.
  • Currently preferred structural materials contain collagens.
  • the matrix further may be treated with an agent or agents to increase the number of pores and/or micropits on its surfaces, so as to enhance the influx, proliferation and differentiation of migratory progenitor cells from the body of the mammal.
  • the loss of hepatic tissue function results from fibrosis or scar tissue formation, formed in response to an initial or repeated injury to the tissue.
  • the degree of scar tissue formation generally depends on the regenerative properties of the injured tissue, and on the degree and type of injury.
  • repeated tissue damage results in liver cirrhosis which destroys normal hepatic architecture by fiberous septa, causing vascular disorganization and perfusion deficits that impair liver function and unchecked, lead to hepatic failure.
  • the invention provides methods and compositions that may be used to prevent and/or substantially inhibit the formation of scar tissue in hepatic tissue by providing the morphogens, or morphogen-stimulated cells, to a newly injured tissue locus (see below).
  • the morphogens of this invention also may be used to increase or regenerate a liver progenitor or stem cell population in a mammal.
  • progenitor cells may be isolated from an individual's bone marrow, stimulated ex vivo for a time and at a morphogen concentration sufficient to induce the cells to proliferate, and returned to the bone marrow.
  • Other sources of progenitor cells that may be suitable include biocompatible cells obtained from a cultured cell line, stimulated in culture, and subsequently provided to the body.
  • the morphogen may be provided systemically, or implanted, injected or otherwise provided to a progenitor cell population in an individual to induce its mitogenic activity in vivo.
  • an agent capable of stimulating morphogen expression in the progenitor cell population of interest may be provided to the cells in vivo, for example systemically, to induce mitogenic activity.
  • the morphogens also may be used to support the growth and maintenance of differentiated cells, inducing existing differentiated cells to continue expressing their phenotype. It is anticipated that this activity will be particularly useful in the treatment of liver disorders where loss of liver function is caused by cells becoming metabolically senescent or quiescent.
  • Application of the protein directly to the cells to be treated, or providing it by systemic injection, can be used to stimulate these cells to continue expressing their phenotype, thereby significantly reversing the effects of the dysfunction.
  • administration of an agent capable of stimulating morphogen expression in vivo also may be used.
  • the morphogens of this invention also may be used in gene therapy protocols to stimulate the growth of quiescent cells, thereby potentially enhancing the ability of these cells to incorporate exogenous DNA.
  • the method disclosed is useful for redifferentiating transformed cells, particularly transformed cells of parenchymal origin, such that the morphogen-treated cells are induced to display a morphology characteristic of untransformed cells.
  • the morphogens previously have been found to induce redifferentiation of transformed embryonic cells and cells of neuronal origin to a morphology characteristic of untransformed cells.
  • Morphogen treatment preferably induces cell rounding and cell aggregation (clumping), cell-cell adhesion, and CAM production.
  • the methods described herein are anticipated to substantially inhibit or reduce hepatocytic cell tumor formation and/or proliferation in liver tissue. It is anticipated that the methods of this invention will be useful in substantially reducing the effects of various carcinomas and sarcomas of liver tissue origin, including hepatocellular carcinomas, bileduct carcinomas, hepatoblastomas, and hemangiosarcomas. In addition, the method also is anticipated to aid in inhibiting neoplastic lesions caused by metastatic tissue. Metastatic tumors are one of the most common neoplasms of the liver, as they can reaching the liver through the bloodstream or lymph nodes. Metastatic tumors may damage hepatic function for example, by distorting normal liver tissue architecture, blocking or inhibiting blood flow, and/or by stimulating the body's immune response.
  • the morphogens described herein are useful for providing hepatocellular protective effects to alleviate liver tissue damage associated with the body's immune/inflammatory response to an initial injury to the tissue.
  • a response may follow acute or chronic trauma to hepatic tissue, caused, for example, by an autoimmune dysfunction, neoplastic lesion, infection, chemical or mechanical trauma, disease or by partial or complete interruption of blood flow to hepatocytes, for example following ischemia or hypoxia, or by other trauma to the liver or surrounding material.
  • portal hypertension is a significant liver disease caused by reduced blood flow through the portal vein and is characterized by tissue necrosis and cirrhosis.
  • Application of the morphogen directly to the cells to be treated, or providing the morphogen to the mammal systemically, for example, intravenously or indirectly by oral administration, may be used to alleviate and/or inhibit the immunologically related response to a hepatic tissue injury.
  • administration of an agent capable of stimulating morphogen expression and/or secretion in vivo, preferably at the site of injury also may be used.
  • the morphogen or agent may be provided prior to induction of the injury to provide a cytoprotective effect to the liver tissue at risk.
  • hepatic tissues and organs for transplantation also are subject to the tissue destructive effects associated with the recipient host body's inflammatory response following transplantation. It is currently believed that the initial destructive response is due in large part to reperfusion injury to the transplanted organ after it has been transplanted to the organ recipient.
  • liver or hepatic tissue transplantation depends greatly on the preservation of the tissue activity (e.g., tissue or organ viability) at the harvest of the organ, during storage of the harvested organ, and at transplantation.
  • tissue activity e.g., tissue or organ viability
  • preservation of organs such as lungs, pancreas, heart and liver remains a significant stumbling block to the successful transplantation of these organs.
  • U.S. Pat. No. 4,952,409 describes a superoxide dismutase-containing liposome to inhibit reperfusion injury.
  • U.S. Pat. No. 5,002,965 describes the use of ginkolides, known platelet activating factor antagonists, to inhibit reperfusion injury.
  • the morphogen may be administered to transplant tissue to enhance the viability of the tissue, to alleviate the tissue damage associated with immune response-mediated tissue destruction and/or to provide a cytoprotective effect to tissue at risk for such damage.
  • transplant tissues include hepatic tissue grafts which may be allogenic, autologous and/or synthetic (e.g., cultured cells attached to an artificial matrix), and whole or partial livers.
  • the transplant tissue e.g., liver, lung, kidney, pancreas, heart, etc.
  • the morphogen also preferably is provided to the tissue prior to, or concomitant with the tissue harvest, e.g., as a prophylactic, to provide a cytoprotective effect to the tissue.
  • the morphogens described herein also may be used in a gene therapy protocol and/or as part of a drug delivery protocol to correct a protein deficiency in a mammal, resulting, for example, from a genetic disorder or other dysfunction to the protein-producing tissue.
  • the methods and compositions of this invention are contemplated for use in providing to the mammal an in vivo protein-producing mechanism for correcting any protein deficiency in the mammal.
  • proteins include proteins normally expressed and/or secreted by hepatic tissue and which play a role in liver-related functions, proteins normally expressed and secreted by the liver and which function elsewhere in the body, and proteins not normally expressed by hepatic tissue.
  • Cells competent for expressing one or more proteins necessary to overcome the protein deficiency in vivo may be stimulated to proliferate ex vivo, and then implanted at a morphogenically permissive site at a liver-specific tissue locus in vivo.
  • the competent cells may be attached to a scaffold-like structure prior to implantation.
  • the competent cells may be attached to a synthetic or formulated matrix and implanted together with a morphogen at an extra-hepatic site in vivo, such as within the folds of the mesentery, or other associated vascularized tissue locus capable of providing the necessary nutrients and gas exchange to the cells.
  • a detailed description of useful extra-hepatic loci are described, for example, in WO90/12604, published Nov.
  • Exposing primary hepatocytes to a morphogen stimulates their proliferation (see below), thereby enhancing their cellular viability upon implantation, accelerating tissue development, and reducing the original cell population required to seed the matrix.
  • implantation with a morphogen eliminates the need for partial hepatectomy to stimulate proliferation, and enhances cellular viability by inhibiting the inflammatory/immune response typically associated with such a procedure, overcoming the significant hepatocyte cell loss typically seen in this procedure.
  • Cells competent for correcting a protein deficiency include allogenic primary hepatocytes, preferably from a serotypically compatible individual and competent for expressing the protein or proteins of interest, and autologous cells transfected with the genetic material necessary to express the protein of interest.
  • primary hepatocytes may be removed from the patient by biopsy, transfected using standard recombinant DNA technology, proliferated, attached to a matrix and reimplanted together with a morphogen.
  • the morphogen is provided to the cells during transfection and proliferation to enhance the mitogenic activity (and nucleic acid uptake) of these cells.
  • morphogen is adsorbed to the matrix surface to which the cells are attached and the complex implanted as a single entity ("cell-matrix structure".)
  • administration of morphogen refers to the administration of the morphogen, either alone or in combination with other molecules.
  • the mature form of the morphogen may be provided in association with its precursor "pro" domain, which is known to enhance the solubility of the protein.
  • the pro form of the morphogen e.g., defined, for example, by amino acid residues 30-431 of OP1, Seq. I.D. No. 16, see below
  • Other useful molecules known to enhance protein solubility include casein and other milk components, as well as various serum proteins.
  • tissue targeting molecules capable of directing the morphogen or morphogen-stimulating agent to hepatic tissue.
  • Tissue targeting molecules envisioned to be useful in the treatment protocols of this invention include antibodies, antibody fragments or other binding proteins which interact specifically with surface molecules on nerve tissue cells.
  • Still another useful tissue targeting molecule may include part or all of the morphogen precursor "pro" domain.
  • Associated tissue targeting or solubility-enhancing molecules also may be covalently linked to the morphogen using standard chemical means, including acid-labile linkages, which likely will be preferentially cleaved in the acidic environment of bone remodeling sites.
  • the morphogens and morphogen-stimulating agents also may be provided to the liver tissue together with other molecules ("cofactors") known to have a beneficial effect in treating damaged hepatic tissue, particularly cofactors capable of mitigating or alleviating symptoms typically associated with hepatic tissue damage and/or loss.
  • cofactors include antiseptics, antibiotics, tetracycline, aminoglycosides, macrolides, penicillins and cephalosporins, and other, non-steroidal anti-inflammatory agents.
  • proteins originally identified as osteogenic proteins such as the OP-1 (comprising, e.g., the sequence shown in Seq. ID No. 5 or 6), OP-2 (comprising, e.g., the sequence shown in Seq. ID No. 7 or 8) and CBMP2 (comprising, e.g., the sequence shown in Seq. ID No. 9 or 10) proteins, as well as amino acid sequence-related proteins such as DPP (from Drosophila; comprising, e.g., the sequence shown in Seq. ID No. 11, Vgl (from Xenopus; comprising, e.g., the sequence shown in Seq. ID No.
  • DPP from Drosophila
  • Vgl from Xenopus
  • Vgr-1 from mouse; comprising, e.g., the sequence shown in Seq. ID No. 13, see U.S. Pat. No. 5,011,691 to Oppermann et al.
  • GDF-1 from mouse; comprising, e.g., the sequence shown in Seq. ID No. 14, see Lee (1991) PNAS 88:4250-4254), all of which are presented in Table
  • 60A protein from Drosophila comprising, e.g., the sequence shown in, Seq. ID No. 24, see Wharton et al. (1991) PNAS 88:9214-9218).
  • the members of this family which include members of the TGF- ⁇ super-family of proteins, share substantial amino acid sequence homology in their C-terminal regions.
  • the proteins are translated as a precursor, having an N-terminal signal peptide sequence, typically less than about 30 residues, followed by a "pro" domain that is cleaved to yield the mature sequence.
  • the "pro" form of the protein includes both the pro domain and the mature domain, and forms a soluble species that apprears to be the primary form secreted from cultured mammalian cells.
  • the signal peptide is cleaved rapidly upon translation, at a cleavage site that can be predicted in a given sequence using the method of Von Heijne ((1986) Nucleic Acids Research 14:4683-4691).
  • Table I describes the various morphogens identified to date, including their nomenclature as used herein, their Seq. ID references, and publication sources for the amino acid sequences for the full length proteins not included in the Seq. Listing. The disclosure of these publications is incorporated herein by reference.
  • the OP-2 proteins (comprising, e.g., Seq. ID Nos. 7 and 8) have an additional cysteine residue in this region (e.g., see residue 41 of Seq. ID Nos. 7 and 8), in addition to the conserved cysteine skeleton in common with the other proteins in this family.
  • the GDF-1 protein (comprising, e.g., Seq. ID No. 14), has a four amino acid insert within the conserved skeleton (residues 44-47 of Seq. ID No. 14) but this insert likely does not interfere with the relationship of the cysteines in the folded structure.
  • the CBMP2 proteins (comprising, e.g., Seq. ID Nos. 9 and 10) are missing one amino acid residue within the cysteine skeleton.
  • a morphogen is a dimeric protein comprising a pair of polypeptide chains, wherein each polypeptide chain comprises at least the C-terminal six cysteine skeleton defined by residues 43-139 of Seq. ID No.
  • cysteines e.g., amino acid insertions or deletions which alter the linear arrangement of the cysteines in the sequence but not their relationship in the folded structure
  • the dimeric protein species comprising the pair of polypeptide chains has the appropriate three-dimensional structure, including the appropriate intra- or inter-chain disulfide bonds such that the protein is capable of acting as a morphogen as defined herein.
  • the morphogens generally are capable of all of the following biological functions in a morphogenically permissive environment: stimulating proliferation of progenitor cells; stimulating the differentiation of progenitor cells; stimulating the proliferation of differentiated cells; and supporting the growth and maintenance of differentiated cells, including the "redifferentiation" of transformed cells.
  • these morphogens are capable of inducing redifferentiation of committed cells under appropriate environmental conditions.
  • the morphogens of this invention comprise one of two species of generic amino acid sequences: Generic Sequence 1 (Seq. ID No. 1) or Generic Sequence 2 (Seq. ID No. 2); where each Xaa indicates one of the 20 naturally-occurring L-isomer, ⁇ -amino acids or a derivative thereof.
  • Generic Sequence 1 comprises the conserved six cysteine skeleton and Generic Sequence 2 comprises the conserved six cysteine (at residue 36 of Seq. ID No. 2) skeleton plus the additional cysteine identified in OP-2 (comprising, e.g., Seq. ID No. 6 or 7).
  • these sequences further comprise the following additional sequence at their N-terminus: ##STR1##
  • Generic Sequence 3 (Seq. ID No. 3), Generic Sequence 4 (Seq. ID No. 4), Generic Sequence 5 (Seq. ID No. 30) and Generic Sequence 6 (Seq. ID No. 31).
  • Generic Sequences 3 and 4 are composite amino acid sequences of the following proteins presented in Table II: human OP-1 (hOP-1, comprising, e.g., Seq. ID Nos.
  • mouse OP-1 (mOP-1, comprising, e.g., Seq. ID Nos. 6 and 18-19), human and mouse OP-2 (comprising, e.g., Seq. ID Nos. 7, 8, and 20-22), CBMP2A (Seq. ID No. 9), CBMP2B (comprising, e.g., Seq. ID No. 10), DPP (from Drosophila comprising, e.g, Seq. ID No. 11), Vgl, (from Xenopus comprising, e.g., Seq. ID No. 12), Vgr-1 (from mouse comprising, e.g., Seq. ID No.
  • the generic sequences include both the amino acid identity shared by the sequences in Table II, as well as alternative residues for the variable positions within the sequence. Note that these generic sequences allow for an additional cysteine at position 41 or 46 in Generic Sequences 3 or 4 (Seq. ID Nos. 3 or 4), respectively, providing an appropriate cysteine skeleton where inter- or intramolecular disulfide bonds can form, and contain certain critical amino acids which influence the tertiary structure of the proteins.
  • Generic Sequence 5 (Seq. ID No. 30) and Generic Sequence 6 (Seq. ID No. 31) accommodate the homologies shared among all the morphogen protein family members identified in Table II.
  • Generic Sequences 5 and 6 are composite amino acid sequences of human OP-1 (hOP-1, comprising, e.g., Seq. ID Nos. 5 and 16-17), mouse OP-1 (mOP-1comprising, e.g., Seq. ID Nos. 6 and 18-19), human and mouse OP-2 (comprising, e.g., Seq. ID Nos. 7, 8, and 20-22), CBMP2A (comprising, e.g., Seq. ID No.
  • CBMP2B (comprising, e.g., Seq. ID No. 10), DPP (from Drosophila comprising, e.g., Seq. ID No. 11), Vgl, (from Xenopus comprising, e.g., Seq. ID No. 12), Vgr-1 (from mouse comprising, e.g., Seq. ID No. 13), and GDF-1 (from mouse comprising, e.g., Seq. ID No. 14), human BMP3 (comprising, e.g., Seq. ID No. 26), human BMP5 (comprising, e.g., Seq. ID No. 27), human BMP6 (comprising, e.g., Seq. ID No. 28) and 60(A) (from Drosophila comprising, e.g., Seq.
  • the generic sequences include both the 25 amino acid identity shared by these sequences in the C-terminal domain, defined by the six and seven cysteine skeletons (Generic Sequences 5 and 6, respectively), as well as alternative residues for the variable positions within the sequence.
  • Generic Sequences 3 and 4 (Seq ID. Nos. 2 and 4)
  • Generic Sequences 5 and 6 (Seq. ID Nos. 30 and 31) allow for an additional cysteine at position 41 (Generic Sequence 5) or position 46 (Generic Sequence 6), providing an appropriate cysteine skeleton where inter- or intramolecular disulfide bonds can form, and containing certain critical amino acids which influence the tertiary structure of the proteins.
  • Particularly useful sequences for use as morphogens in this invention include the C-terminal domains, e.g., the C-terminal 96-102 amino acid residues of vgl (Seq. ID No. 12), Vgr-1 (Seq. ID No. 13), DPP (Seq. ID No. 11), OP-1 (Seq. ID No. 5 or 6), OP-2 (Seq. ID No. 7 or 8), CBMP-2A (Seq. ID No. 9), CBMP-2B (Seq. ID No. 10, GDF-1 (Seq. ID No. 14) Table II, below, as well as proteins comprising the C-terminal domains of 60A (residues 354-455 of Seq.
  • BMP3 (Seq. ID No. 26), BMP5 (Seq. ID No. 27) and BMP6 (Seq. ID No. 28) see also Table II, all of which include at least the conserved six or seven cysteine skeleton.
  • Other sequences include the inhibins/activin proteins (see, for example, U.S. Pat. Nos. 4,968,590 and 5,011,691).
  • other useful sequences are those sharing at least 70% amino acid sequence homology or "similarity", and preferably 80% homology or similarity with any of the sequences above. These are anticipated to include allelic and species variants and mutants, and biosynthetic muteins, as well as novel members of this morphogenic family of proteins. Particularly envisioned in the family of related proteins are those proteins exhibiting morphogenic activity and wherein the amino acid changes from the preferred sequences include conservative changes, e.g., those as defined by Dayoff et al., Atlas of Protein Sequence and Structure; vol. 5, Suppl. 3, pp. 345-362, (M. O. Dayoff, ed., Nat'l BioMed. Research Fdn., Washington, D.C. 1979).
  • the currently most preferred protein sequences useful as morphogens in this invention include those having greater than 60% identity, preferably greater than 65% identity, with the amino acid sequence defining the conserved six cysteine skeleton of hOP1 (e.g., residues 43-139 of Seq. ID No. 5).
  • These most preferred sequences include both allelic and species variants of the OP-1 and OP-2 proteins (comprising, respectively, e.g., Seq. ID Nos. 5-8), including the Drosophila 60A protein (comprising e.g., Seq. ID NO. 25).
  • useful morphogens include active proteins comprising species of polypeptide chains having the generic amino acid sequence herein referred to as "OPX"(Seq. ID No. 29), which accommodates the homologies between the various identified species of OP1 and OP2 (comprising the sequences shown in Seq. ID Nos. 5-8(Seq. ID No. 29).
  • the morphogens useful in the methods, composition and devices of this invention include proteins comprising any of the polypeptide chains described above, whether isolated from naturally-occurring sources, or produced by recombinant DNA or other synthetic techniques, and includes allelic and species variants of these proteins, naturally-occurring or biosynthetic mutants thereof, as well as various truncated and fusion constructs. Deletion or addition mutants also are envisioned to be active, including those which may alter the conserved C-terminal cysteine skeleton, provided that the alteration does not functionally disrupt the relationship of these cysteines in the folded structure. Accordingly, such active forms are considered the equivalent of the specifically described constructs disclosed herein.
  • the proteins may include forms having varying glycosylation patterns, varying N-termini, a family of related proteins having regions of amino acid sequence homology, and active truncated, chimeric and/or mutated forms of native or biosynthetic proteins, produced by expression of recombinant DNA in host cells.
  • the morphogenic proteins can be expressed from intact, chimeric and/or truncated cDNA or from synthetic DNAs in procaryotic or eucaryotic host cells, and purified, cleaved, refolded, and dimerized to form morphogenically active compositions.
  • Currently preferred host cells include E. coli or mammalian cells, such as CHO, COS or BSC cells.
  • a detailed description of the morphogens useful in the methods, compositions and devices of this invention is disclosed in commonly owned U.S. patent application Ser. Nos. 752,764, filed Aug. 30, 1991 (now abandoned), and 667,274, filed Mar. 11, 1991 (now abandoned), the disclosure of which are incorporated herein by reference.
  • skilled genetic engineers can isolate genes from cDNA or genomic libraries of various different species which encode appropriate amino acid sequences, or construct DNAs from oligonucleotides, and then can express them in various types of host cells, including both procaryotes and eucaryotes, to produce large quantities of active proteins capable of maintaining liver function in a mammal, including correcting liver function deficiencies and stimulating hepatic tissue regeneration and repair in a variety of mammals, including humans.
  • FIG. 1 is a photograph of a Northern blot identifying OP-1-specific mRNA expression in developing liver tissue in embryonic and postnatal mouse;
  • FIG. 2 is a photograph showing the effect of phosphate buffered saline (PBS, animal 1) or morphogen (OP-1, animal 2) on partially hepatectomized rats (arrow indicates the treated lobe in both animals);
  • PBS phosphate buffered saline
  • OP-1 morphogen
  • FIG. 3 is a photograph of a Northern blot of mRNA isolated from sham-operated (lanes 3, 5, 7, 9, 11, 13 and 15) and partially hepatectomized rats (lanes 2, 4, 6, 8, 10, 12, 14) at 6 hr intervals between 12-96 hours post surgery, probed with an mOP-1-specific probe;
  • FIG. 4 is a photograph of a Northern blot of mRNA isolated from galactosamine-treated rats and probed with mOP-1-specific probe on days 0-7, 10 (lanes 1-9, respectively);
  • FIGS. 5 are schematic representations of morphogen inhibition of early mononuclear phagocytic cell multinuclearization in vivo.
  • FIGS. 6 graphs the effects of a morphogen (e.g., OP-1, FIGS. 6A and 6C) and TGF-B (FIG. 6B and 6D) on collagen (6A and 6B) and hyaluronic acid (6C and 6D) production in primary fibroblast cultures.
  • a morphogen e.g., OP-1, FIGS. 6A and 6C
  • TGF-B FIGG. 6B and 6D
  • proteins described herein are effective agents for maintaining liver function in a mammal.
  • these proteins are capable of inducing hepatic tissue regeneration and repair under conditions where true tissue morphogenesis typically does not occur, including stimulating the proliferation and differentiation of hepatocytic progenitor cells.
  • the proteins also are capable of providing a cytoprotective effect to alleviate the tissue destructive effects associated with immunologically-related hepatic tissue damage. Accordingly, the proteins may be used as part of a protocol for regenerating damaged or lost hepatic tissue, correcting a liver function deficiency, and enhancing the viability of a tissue or organ to be transplanted in a mammal.
  • the morphogens also may be used in a gene therapy protocol to correct a protein deficiency in a mammal.
  • suitable morphogens useful in the methods, compositions and devices of this invention, as well as methods for their administration and application, and numerous, nonlimiting examples which 1) illustrate the suitability of the morphogens and morphogen-stimulating agents described herein as therapeutic agents for maintaining liver function in a mammal; and 2) provide assays with which to test candidate morphogens and morphogen-stimulating agents for their efficacy.
  • the examples demonstrate the expression distribution of endogenous morphogen (Example 1), the expression of endogenous morphogen during liver formation in a developing embryo (Example 2), the ability of morphogens to induce proliferation of primary hepatocytes (Example 3), morphogen-induced liver tissue morphogenesis following partial hepatectomy (Example 4); endogenous morphogen expression during hepatic tissue repair following toxin-induced tissue damage (Examples 5); the inhibitory effect of morphogens on the body's cellular and humoral immune response (Example 6); effect of morphogen on fibrogenesis (Example 7); morphogen utility in liver diagnostic procedures (Example 8), and a screening assay for testing candidate morphogen-stimulating agents (Example 9).
  • a protein is morphogenic if it is capable of inducing the developmental cascade of cellular and molecular events that culminate in the formation of new, organ-specific tissue and comprises at least the conserved C-terminal six cysteine skeleton or its functional equivalent (see supra).
  • the morphogens generally are capable of all of the following biological functions in a morphogenically permissive environment: stimulating proliferation of progenitor cells; stimulating the differentiation of progenitor cells; stimulating the proliferation of differentiated cells; and supporting the growth and maintenance of differentiated cells, including the "redifferentiation" of transformed cells.
  • a candidate morphogen or morphogen composition can be evaluated for in vivo morphogenic utility generally according to the procedures set forth in U.S. Ser. No. 07/752,764 commonly owned, abandoned.
  • the proteins and compositions may be injected or surgically implanted in a mammal, following any of a number of procedures well known in the art. For example, surgical implant bioassays may be performed essentially following the procedure of Sampath et al. (1983) PNAS 80:6591-6595.
  • Histological sectioning and staining is preferred to determine the extent of morphogenesis in vivo, particularly in tissue repair procedures.
  • Excised implants are fixed in Bouins Solution, embedded in paraffin, and cut into 6-8 ⁇ m sections. Staining with toluidine blue or hemotoxylin/eosin demonstrates clearly the ultimate development of the new tissue. Twelve day implants are usually sufficient to determine whether the implants contain newly induced tissue.
  • tissue morphogenesis In addition to histological evaluation, biological markers may be used as a marker for tissue morphogenesis.
  • Useful markers include tissue-specific enzymes whose activity may be assayed (e.g., spectrophotometrically) after homogenization of the implant. These assays may be useful for quantitation and for obtaining an estimate of tissue formation quickly after the implants are removed from the animal. For example, alkaline phosphatase activity may be used as a marker for osteogenesis.
  • Incorporation of systemically provided morphogens may be followed using tagged morphogens (e.g., radioactively labelled) and determining their localization in new tissue, and/or by monitoring their disappearance from the circulatory system using a standard pulse-chase labeling protocol.
  • tagged morphogens e.g., radioactively labelled
  • the morphogen also may be provided with a tissue-specific molecular tag, whose uptake may be monitored and correlated with the concentration of morphogen provided.
  • the morphogen to be assayed according to the above-described exemplary procedures can be purified from naturally-sourced material, or can be recombinantly produced from procaryotic or eucaryotic host cells, into which genetic material encoding a morphogen, e.g., genetic material bearing one of the nucleic acid sequences disclosed herein, has been introduced.
  • the above-described exemplary procedures can be used to determine whether a novel protein suspected of being a morphogen indeed has morphogenic activity.
  • Particularly useful proteins include those which comprise the naturally derived sequences disclosed in Table II.
  • Other useful sequences include biosynthetic constructs such as those disclosed in U.S. Pat. No. 5,011,691, the disclosure of which is incorporated herein by reference (e.g., COP-1, COP-3, COP-4, COP-5, COP-7, and COP-16).
  • morphogens useful in the methods and compositions of this invention also may be described by morphogenically active proteins having amino acid sequences sharing 70% or, preferably, 80% homology (similarity) with any of the sequences described above, where "homology" is as defined herein above.
  • Generic Sequences 1, 2, 3, 4, 5 and 6 Seq. ID Nos. 1, 2, 3, 4, 30 and 31.
  • Generic sequences 1 and 2 also may include, at their N-terminus, the sequence ##STR6##
  • Table II compares the amino acid sequences of the active regions of native proteins that have been identified as morphogens, including human OP-1 (hOP-1, Seq. ID Nos. 5 and 16-17), mouse OP-1 (mOP-1, Seq. ID Nos. 6 and 18-19), human and mouse OP-2 (Seq. ID Nos. 7, 8, and 20-b 23), CBMP2A (Seq. ID No. 9), CBMP2B (Seq. ID No. 10), BMP3 (Seq. ID No. 26), DPP (from Drosophila, Seq. ID No. 11), Vgl, (from Xenopus, Seq. ID No. 12), Vgr-1 (from mouse, Seq. ID No.
  • amino acid residue 60 of CBMP-2A and CBMP-2B is "missing".
  • both these amino acid sequences in this region comprise Asn-Ser (residues 58, 59), with CBMP-2A then comprising Lys and Ile, whereas CBMP-2B comprises Ser and Ile.
  • the currently most preferred protein sequences useful as morphogens in this invention include those having greater than 60% identity, preferably greater than 65% identity, with the amino acid sequence defining the conserved six cysteine skeleton of hOP1 (e.g., residues 43-139 of Seq. ID No. 5). These most preferred sequences include both allelic and species variants of the OP-1 and OP-2 proteins (Seq. ID Nos. 5-8), including the Drosophila 60A protein (e.g. Seq. ID No. 25). Accordingly, in still another preferred aspect, the invention includes morphogens comprising species of polypeptide chains having the generic amino acid sequence referred to herein as "OPX" (Seq. ID No.
  • Each Xaa at a given position in OPX independently is selected from the residues occurring at the corresponding position in the C-terminal sequence of mouse or human OP1 or OP2 (see Seq. ID Nos. 5-8 and/or Seq. ID Nos. 16-23).
  • the morphogens of this invention may be implanted surgically, dispersed in a biocompatible, preferably in vivo biodegradable matrix appropriately modified to provide a structure in which the morphogen may be dispersed and which allows the influx, differentiation and proliferation of migrating progenitor cells.
  • differentiated hepatocytes and/or hepatocytic progenitor cells, stimulated by exposure to the morphogen may be disposed in and attached to a matrix structure and implanted surgically.
  • the matrix preferably also provides signals capable of directing the tissue specificity of the differentiating cells, and provides a morphogenically permissive environment, being essentially free of growth inhibiting signals.
  • the formulated matrix on which the morphogen is disposed may be shaped as desired in anticipation of surgery or may be shaped by the physician or technician during surgery.
  • the matrix preferably is shaped before cells are attached thereto.
  • the matrix preferably is biodegradable in vivo, being slowly absorbed by the body and replaced by new tissue growth, in the shape or very nearly in the shape of the implant.
  • Suitable biocompatible, in vivo biodegradable acellular matrices may be prepared from naturally-occurring tissue.
  • the tissue is treated with suitable agents to substantially extract the cellular, nonstructural components of the tissue.
  • the agents also should be capable of extracting any growth inhibiting components associated with the tissue.
  • the resulting material is a porous, acellular matrix, substantially depleted in nonstructurally-associated components, and preferably containing structural molecules such as collagen, laminin, hyaluronic acid, and the like.
  • the matrix also may be further treated with agents that modify the matrix, increasing the number of pores and micropits on its surfaces.
  • agents that modify the matrix For example, soft tissues such as liver and lung may be thin-sectioned and exposed to a nonpolar solvent such as, for example, 100% ethanol, to destroy the cellular structure of the tissue and extract nonstructural components. The material then is dried and pulverized to yield nonadherent porous particles.
  • Structural tissues such as cartilage and dentin where collagen is the primary component may be demineralized and extracted with guanidine, essentially following the method of Sampath et al. (1983) PNAS 80:6591-6595.
  • pulverized and demineralized dentin is extracted with five volumes of 4M guanidine-HCl, 50 mM Tris-HCl, pH 7.0 for 16 hours at 4° C.
  • the suspension then is filtered.
  • the insoluble material that remains is collected and used to fabricate the matrix.
  • the material is mostly collagenous in manner. It is devoid of morphogenic activity.
  • the matrix particles may further be treated with a collagen fibril-modifying agent that extracts potentially unwanted components from the matrix, and alters the surface structure of the matrix material.
  • Useful agents include acids, organic solvents or heated aqueous media.
  • the currently most preferred agent is a heated aqueous fibril-modifying medium such as water, to increase the matrix particle surface area and porosity.
  • the currently most preferred aqueous medium is an acidic aqueous medium having a pH of less than about 4.5, e.g., within the range of about pH 2-pH 4 which may help to "swell" the collagen before heating.
  • 0.1% acetic acid which has a pH of about 3, currently is most preferred.
  • 0.1 M acetic acid also may be used.
  • aqueous medium (1 g matrix/30 ml aqueous medium) under constant stirring in a water jacketed glass flask, and maintained at a given temperature for a predetermined period of time.
  • Preferred treatment times are about one hour, although exposure times of between about 0.5 to two hours appear acceptable.
  • the temperature employed is held constant at a temperature within the range of about 37° C. to 65° C.
  • the currently preferred heat treatment temperature is within the range of about 45° C to 60° C.
  • the matrix is filtered, washed, lyophilized and used for implant.
  • the matrix also is preferably neutralized prior to washing and lyophilization.
  • a currently preferred neutralization buffer is a 200 mM sodium phosphate buffer, pH 7.0.
  • the matrix preferably first is allowed to cool following thermal treatment, the acidic aqueous medium (e.g., 0.1% acetic acid) then is removed and replaced with the neutralization buffer and the matrix agitated for about 30 minutes. The neutralization buffer then may be removed and the matrix washed and lyophilized.
  • Other useful fibril-modifying treatments include acid treatments (e.g., trifluoroacetic acid and hydrogen fluoride) and solvent treatments such as dichloromethane, acetonitrile, isopropanol and chloroform, as well as particular acid/solvent combinations.
  • acid treatments e.g., trifluoroacetic acid and hydrogen fluoride
  • solvent treatments such as dichloromethane, acetonitrile, isopropanol and chloroform, as well as particular acid/solvent combinations.
  • the treated matrix may be washed to remove any extracted components, following a form of the procedure set forth below:
  • TBS Tris-buffered saline
  • UTBS Tris-buffered saline
  • RT room temperature
  • Suitable matrix scaffolds may be created from biocompatible, preferably in vivo biodegradable synthetic polymers, including polylactic acid, polyglycolic acid, polyanhydride, polybutyric acid, and copolymers thereof, and/or synthetic-inorganic materials, such as hydroxyapatite, tricalcium phosphate, and other calcium phospates.
  • biocompatible preferably in vivo biodegradable synthetic polymers, including polylactic acid, polyglycolic acid, polyanhydride, polybutyric acid, and copolymers thereof, and/or synthetic-inorganic materials, such as hydroxyapatite, tricalcium phosphate, and other calcium phospates.
  • polymers are well described in the art and are available commercially.
  • polymers composed of polyactic acid e.g., MW 100 kDa
  • 80% polylactide/20% glycoside or poly 3-hydroxybutyric acid e.g., MW 30 kDa
  • the polymer compositions generally are obtained in particulate form and the osteogenic devices preferably fabricated under nonaqueous conditions (e.g., in an ethanol-trifluoroacetic acid solution, EtOH/TFA) to avoid hydrolysis of the polymers.
  • nonaqueous conditions e.g., in an ethanol-trifluoroacetic acid solution, EtOH/TFA
  • osteogenic devices fabricated with morphogenic protein, solubilized in EtOH/TFA as described below, and a matrix composed of polylactic acid, poly 3-hydroxybutyric acid, or 80% polylactide/20% glycoside are all osteogenically active when implanted in the rat model and bioassayed as described in U.S. Pat. No. 4,968,590 (e.g., as determined by calcium content, alkaline phosphatase levels and histology of 12-day implants).
  • tissue-specific matrices may be formulated synthetically if appropriately modified.
  • porous biocompatible, in vivo biodegradable synthetic matrices are disclosed in PCT publication US91/03603, published Dec. 12, 1991 (WO91/18558), the disclosure of which is hereby incorporated by reference.
  • the matrix comprises a porous crosslinked structural polymer of biocompatible, biodegradable collagen and appropriate, tissue-specific glycosaminoglycans as tissue-specific cell attachment factors.
  • Collagen derived from a number of sources may be suitable for use in these synthetic matrices, including insoluble collagen, acid-soluble collagen, collagen soluble in neutral or basic aqueous solutions, as well as those collagens which are commercially available.
  • Glycosaminoglycans or mucopolysaccharides are hexosamine-containing polysaccharides of animal origin that have a tissue specific distribution, and therefore may be used to help determine the tissue specificity of the morphogen-stimulated differentiating cells. Reaction with the GAGs also provides collagen with another valuable property, i.e., inability to provoke an immune reaction (foreign body reaction) from an animal host.
  • GAGs are made up of residues of hexoseamines glycosidically bound and alternating in a more-or-less regular manner with either hexouronic acid or hexose moieties (see, e.g., Dodgson et al. in Carbohydrate Metabolism and its Disorders (Dickens et al., eds.) Vol. 1, Academic Press (1968)).
  • Useful GAGs include hyaluronic acid, heparin, heparin sulfate, chondroitin 6-sulfate, chondroitin 4-sulfate, dermatan sulfate, and keratin sulfate.
  • GAGs are suitable for forming the matrix described herein, and those skilled in the art will either know or be able to ascertain other suitable GAGs using no more than routine experimentation.
  • mucopolysaccharides see Aspinall, Polysaccharides, Pergamon Press, Oxford (1970).
  • chondroitin-6-sulfate can be used where endochondral bone formation is desired.
  • Heparin sulfate may be used to formulate synthetic matrices for use in lung tissue repair.
  • Collagen can be reacted with a GAG in aqueous acidic solutions, preferably in diluted acetic acid solutions.
  • a GAG aqueous acidic solutions
  • coprecipitates of tangled collagen fibrils coated with GAG results.
  • This tangled mass of fibers then can be homogenized to form a homogeneous dispersion of fine fibers and then filtered and dried.
  • Insolubility of the collagen-GAG products can be raised to the desired degree by covalently cross-linking these materials, which also serves to raise the resistance to resorption of these materials.
  • any covalent cross-linking method suitable for cross-linking collagen also is suitable for cross-linking these composite materials, although crosslinking by a dehydrothermal process is preferred.
  • the crosslinked particles When dry, the crosslinked particles are essentially spherical, with diameters of about 500 ⁇ m. Scanning electron miscroscopy shows pores of about 20 ⁇ m on the surface and 40 ⁇ m on the interior.
  • the interior is made up of both fibrous and sheet-like structures, providing surfaces for cell attachment.
  • the voids interconnect, providing access to the cells throughout the interior of the particle.
  • the material appears to be roughly 99.5% void volume, making the material very efficient in terms of the potential cell mass that can be grown per gram of microcarrier.
  • morphogens described herein can be combined and dispersed in a suitable matrix using any of the methods described below:
  • Matrix is added to the morphogen dissolved in guanidine-HC1. Samples are vortexed and incubated at a low temperature. Samples are then further vortexed. Cold absolute ethanol is added to the mixture which is then stirred and incubated. After centrifugation (microfuge, high speed) the supernatant is discarded. The matrix is washed with cold concentrated ethanol in water and then lyophilized.
  • Morphogen preparations in physiological saline may also be vortexed with the matrix and lyophilized to produce morphogenically active material.
  • Primary hepatocytes or progenitor cells may be implanted in the mammal in one embodiment of the invention.
  • implanted hepatocytes may act as gene therapy tools capable of correcting a protein deficiency in vivo by expressing and/or secreting the deficient protein when implanted at a liver tissue or associated locus in a mammal.
  • the liver functions in part as a protein-synthesizing organ, responsible for the production of myriad proteins which are secreted from the liver and transported, e.g., via the circulatory system, to function elsewhere in the body.
  • hepatic tissue like renal and pancreatic tissue, provides an endogenous system having the necessary mechanisms in place to act as a vector for the in vivo production of (including secretion of) any protein, including proteins not normally expressed by hepatic tissue.
  • protein deficiencies that can be treated by this method include proteins involved in normal liver functions, proteins normally produced and secreted by the liver to function elsewhere in the body, and proteins not normally produced by hepatic tissue.
  • the hepatocytes must be provided with means for expressing that protein.
  • the cell may be genetically engineered as described below to induce expression of the endogenous genetic sequence encoding the protein.
  • a nucleic acid encoding the protein and under control of a suitable promoter (and enhancer), may be provided to the cell as described below.
  • the cell may be provided with one or more regulatory elements so that expression of the protein of interest mimics that of the endogenously produced protein, particularly where normal protein expression depends on changes in the physiological concentration of a molecule. For example, insulin production is regulated by blood glucose levels in the body.
  • the protein deficiency to be corrected may result from defective endogenous protein production, including protein expression and/or secretion, or the protein's efficacy may be reduced due to a preexisting condition in the individual.
  • the defect may be genetic or may be induced by, for example, damage to the protein-synthesizing tissue.
  • Exemplary hepatic proteins that may be used in a gene therapy include, but are not limited to, albumin and albumin synthesis proteins, blood clotting factors, including fibrinogen and thrombin, Factor VIII, iron or copper binding proteins, and vitamin A binding proteins.
  • non-hepatic proteins that may be used in a gene therapy include, but are not limited to, insulin, tissue plasminogen activator (TPA), erythropoietin, growth hormones, and the like.
  • TPA tissue plasminogen activator
  • the cells also may act as in vivo drug delivery vehicles, capable of producing and secreting one or more therapeutic drugs when implanted at a suitable locus in a mammal.
  • the cells further may be manipulated to modify antigen expression on the cell surface, and limit the in vivo immune response typically induced by foreign material.
  • the cells may be obtained from a donor competent for providing the protein of interest.
  • Cells can be obtained by biopsy or surgical excision from a donor, or from established cell lines.
  • allogenic cells are obtained from a biocompatible donor.
  • autologous cells may be obtained from the patient and modified by recombinant DNA technology to incorporate genetic sequences sufficient to allow the cells to produce the protein or proteins of interest in vivo when the cells are reimplanted in the patient. Protocols and detailed discussions of considerations for introducing foreign genetic material into cells, particularly human cells, are well described in the art.
  • Example 3 A currently preferred protocol for isolating primary hepatocytes from liver tissue is described in Example 3 below. Other methods known in the art also are envisioned to be useful, such as those described, for example, in WO 88/03785. Where pluripotential hemopoietic stem cells are to be used, a useful method for their isolation is described in commonly owned, now-abandoned U.S. Ser. No. 752,764. Briefly, and as described in detail therein, a biocompatible matrix material able to allow the influx of migratory progenitor cells may be implanted at an in vivo site long enough to allow the influx of migratory progenitor cells.
  • a bone-derived, guanidine-extracted matrix formulated as disclosed for example in Sampath et al. ((1983) PNAS 80:6591-6595), or U.S. Pat. No. 4,975,526, may be implanted into a rat, essentially following the method of Sampath et al. (ibid). After three days the implant is removed, and the progenitor cells associated with the matrix dispersed and cultured. Another method is described, for example, in U.S. Pat. No. 5,061,620, issued Oct. 29, 1991, to Tsukamoto et al.
  • Isolated cells may be stimulated in vitro by morphogen exposure, essentially as described in Example 3. Stimulation is performed under sterile conditions, using an appropriate morphogen concentration and incubation period to stimulate the cells. Preferred times and concentration for a given procedure may be determined empirically by the clinician without undue experimentation. In general, a period of from about 10 minutes to 72 hours should be sufficient.
  • Cells may be attached to a matrix by incubating the cells in the presence of matrix for at least a number of hours, e.g., 3-5 hours, or, preferably overnight.
  • An efficient technique for attaching cells to a matrix surface is to place a concentrated suspension of cells on the surface of the matrix material and allow the cells to infiltrate and adsorb to the material. Cells typically attach individually or in small groups. In the absence of added morphogen cells begin rearranging into clusters within 24 hours and within 3 days cells have almost completely infiltrated the support and have organized into large clusters.
  • the morphogen first is adsorbed to the matrix surface and cells subsequently attached thereto.
  • the cell-matrix structure may be maintained in vitro and to allow the cells to proliferate (preferably by exposure to a morphogen or morphogen-stimulting agent) or, alternatively, the complex may be implanted in the animal and the cells allowed to proliferate (and differentiate) in vivo.
  • the cells preferably are provided to a surgically prepared locus where from which necrotic or cirrhotic tissue has been removed, e.g., by surgical, chemical, ablating, or other means known in the medical art.
  • the cells then are provided to the prepared site, preferably attached to a matrix and associated with a morphogen or morphogen-stimulating agent.
  • the cells may be provided to a morphogenically permissive site in a liver-specific locus, e.g., following removal of necrotic and/or cirrhotic tissue, or following excision of sufficient tissue to provide a morphogenically permissive site.
  • the cell-matrix structure may be implanted together with a morphogen or morphogen-stimulating agent at a suitable, vascularized liver-associated locus, such as within the folds of the mesentery.
  • implanting cells together with a morphogen or morphogen-stimulating agent enhances their proliferation and their viability in vivo, such that the new tissue is formed without the significant associated cell loss or delay which characterizes existing protocols and which currently require the use of substantial initial seed cell populations.
  • hepatic tissue growth can be stimulated using the methods described herein without the need of a partial hepatectomy as described in the art.
  • the morphogens described herein functionally inhibit the tissue damage associated with the body's immune response, reducing the need for associated treatments with immunosuppressive drugs.
  • the following sets forth various procedures for evaluating the in vivo morphogenic utility of the morphogens and morphogenic compositions of this invention.
  • the proteins and compositions may be injected or surgically implanted in a mammal, following any of a number of procedures well known in the art.
  • Histological sectioning and staining is preferred to determine the extent of morphogenesis in vivo, particularly in tissue repair procedures.
  • Excised implants are fixed in Bouins Solution, embedded in paraffin, and cut into 6-8 ⁇ m sections. Staining with toluidine blue or hemotoxylin/eosin demonstrates clearly the ultimate development of the new tissue. Twelve day implants are usually sufficient to determine whether the implants contain newly induced tissue.
  • the stages include: (1) leukocytes on day one; (2) mesenchymal cell migration and proliferation on days two and three; (3) chondrocyte appearance on days five and six; (4) cartilage matrix formation on day seven; (5) cartilage calcification on day eight; (6) vascular invasion, appearance of osteoblasts, and formation of new bone on days nine and ten; (7) appearance of osteoclasts and bone remodeling and dissolution of the implanted matrix on days twelve to eighteen; and (8) hematopoietic bone marrow differentiation in the ossicle on day twenty-one.
  • the stages include leukocytes on day one, mesenchymal cell migration and proliferation on days two and three, hepatocyte appearance on days five and six, followed by matrix formation and vascularization.
  • tissue morphogenesis In addition to histological evaluation, biological markers may be used as a marker for tissue morphogenesis.
  • Useful markers include tissue-specific enzymes whose activities may be assayed (e.g., spectrophotometrically) after homogenization of the implant. These assays may be useful for quantitation and for obtaining an estimate of tissue formation quickly after the implants are removed from the animal. For example, alkaline phosphatase activity may be used as a marker for osteogenesis.
  • Incorporation of systemically provided morphogens may be followed using tagged morphogens (e.g., radioactively labelled) and determining their localization in new tissue, and/or by monitoring their disappearance from the circulatory system using a standard pulse-chase labeling protocol.
  • tagged morphogens e.g., radioactively labelled
  • the morphogen also may be provided with a tissue-specific molecular tag, whose uptake may be monitored and correlated with the concentration of morphogen provided.
  • the morphogens of this invention may be used to repair diseased or damaged mammalian tissue.
  • the tissue to be repaired is preferably assessed, and excess necrotic or interfering scar tissue removed as needed, by surgical, chemical, ablating or other methods known in the medical arts.
  • the morphogen then may be provided directly to the tissue locus as part of a sterile, biocompatible composition, either by surgical implantation or injection.
  • a sterile, biocompatible composition containing morphogen-stimulated progenitor cells may be provided to the tissue locus.
  • the existing tissue at the locus whether diseased or damaged, provides the appropriate matrix to allow the proliferation and tissue-specific differentiation of progenitor cells.
  • a damaged or diseased tissue locus particularly one that has been further assaulted by surgical means, provides a morphogenically permissive environment. For some tissues, it is envisioned that systemic provision of the morphogen will be sufficient.
  • the tissue may not be capable of providing a sufficient matrix for cell influx and proliferation.
  • it may be necessary to provide the morphogen or morphogen-stimulated progenitor cells to the tissue locus in association with a suitable, biocompatible formulated matrix, prepared by any of the means described below.
  • the matrix preferably is tissue-specific, in vivo biodegradable, and comprises particles having dimensions within the range of 70-850 ⁇ m, most preferably 150-420 ⁇ m.
  • the morphogens may be provided to an individual by any suitable means.
  • the morphogen or morphogen-stimulating agent (collectively described herein below as the "therapeutic agent") is provided directly to the liver tissue (e.g., locally, as by injection to the tissue locus or by periodic release from a locally implanted osmotic pump).
  • the morphogen or morphogen-stimulating agent is provided directly to the liver tissue (e.g., locally, as by injection to the tissue locus or by periodic release from a locally implanted osmotic pump).
  • oral administration or systemic injection also may be viable administration routes for certain applications, such as part of a protocol to enhance viabilty of a tissue to be transplanted, or as part of a protocol to maintain liver function during a surgical or other therapeutic procedure, or for maintaining liver function in aged or immuno-suppressed individuals, or others at risk for hepatic tissue damage.
  • the morphogen preferably comprises part of an aqueous solution.
  • the solution is physiologically acceptable so that in addition to delivery of the desired morphogen to the patient, the solution does not otherwise adversely affect the patient's electrolyte and volume balance.
  • the aqueous medium for the morphogen thus may comprise normal physiologic saline (0.85-0.9% NaCl, 0.15M), pH 7-7.4.
  • the aqueous solution containing the morphogen can be made, for example, by dissolving the protein in 50% ethanol containing acetonitrile in 0.1% trifluoroacetic acid (TFA) or 0.1% HCl, or equivalent solvents.
  • One volume of the resultant solution then is added, for example, to ten volumes of phosphate buffered saline (PBS), which further may include 0.1-0.2% human serum albumin (HSA).
  • PBS phosphate buffered saline
  • HSA human serum albumin
  • the resultant solution preferably is vortexed extensively.
  • a given morphogen may be made more soluble by association with a suitable molecule.
  • the pro form of the morphogenic protein comprises a species that is soluble in physiologically buffered solutions. In fact, the endogenous protein is thought to be transported in this form. This soluble form of the protein may be obtained from the culture medium of morphogen-secreting mammalian cells.
  • a soluble species may be formulated by complexing the mature dimer (or an active fragment thereof) with part or all of a pro domain.
  • Another molecule capable of enhancing solubility and particularly useful for oral administrations is casein. For example, addition of 0.2% casein increases solubility of the mature active form of OP-1 by 80%.
  • Other components found in milk and/or various serum proteins also may be useful.
  • Formulations for parenteral administration may be prepared by any of the methods well known in the pharmaceutical art, described, for example, in Remington's Pharmaceutical Sciences (Gennaro, A., ed.), Mack Pub., 1990.
  • Formulations may include, for example, polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, hydrogenated naphthalenes, and the like.
  • Formulations for direct administration in particular, may include glycerol and other compositions of high viscosity.
  • Biocompatible, preferably bioresorbable, polymers including, for example, hyaluronic acid, collagen, polybutyrate, tricalcium phosphate, lactide and lactide/glycolide copolymers, may be useful excipients to control the release of the morphogen in vivo.
  • Other potentially useful parenteral delivery systems for these morphogens include ethylene-vinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, and liposomes.
  • the morphogen form found in milk is readily soluble, probably by noncovalent association of the mature, morphogenically active form with part or all of the pro domain of the intact sequence and/or by association with one or more milk components. Accordingly, the compounds provided herein also may be associated with molecules capable of enhancing their solubility in vitro or in vivo.
  • the compounds provided herein also may be associated with molecules capable of targeting the morphogen or morphogen-stimulating agent to liver tissue.
  • molecules capable of targeting the morphogen or morphogen-stimulating agent to liver tissue may be used.
  • an antibody, antibody fragment, or other binding protein that interacts specifically with a surface molecule on liver tissue cells, including hepatocytes or epithelial cells may be used.
  • Useful targeting molecules may be designed, for example, using the single chain binding site technology disclosed, for example, in U.S. Pat. No. 5,091,513.
  • the morphogens provided herein share significant sequence homology in the C-terminal active domains.
  • the sequences typically diverge significantly in the sequences which define the pro domain.
  • the pro domain is thought to be morphogen-specific.
  • the various morphogens identified to date are differentially expressed in the different tissues. Accordingly, without being limited to any given theory, it is likely that, under natural conditions in the body, selected morphogens typically act on a given tissue. Accordingly, part or all of the pro domains which have been identified associated with the active form of the morphogen in solution, may serve as targeting molecules for the morphogens described herein.
  • the pro domains may interact specifically with one or more molecules at the target tissue to direct the morphogen associated with the pro domain to that tissue.
  • another useful targeting molecule for targeting morphogen to hepatic tissue may include part or all of a morphogen pro domain.
  • morphogen species comprising the pro domain may be obtained from culture medium of morphogen-secreting cells.
  • a tissue-targeting species may be formulated by complexing the mature dimer (or an active fragment thereof) with part or all of a pro domain.
  • the morphogens or morphogen-stimulating agents provided herein may be administered alone or in combination with other molecules ("cofactors") known to be beneficial in maintaining liver function, particularly symptom-alleviating cofactors, such as other, non-steroidal anti-inflammatory agents, antiseptics and antibiotics.
  • cofactors such as other, non-steroidal anti-inflammatory agents, antiseptics and antibiotics.
  • compositions can be formulated into pharmaceutical compositions by admixture with pharmaceutically acceptable nontoxic excipients and carriers.
  • compositions may be prepared for direct, or local or systemic administration, particularly in the form of liquid solutions or suspensions; for oral administration, particularly in the form of tablets or capsules; or intranasally, particularly in the form of powders, nasal drops, or aerosols.
  • compositions can be formulated for administration to humans or other mammals in therapeutically effective amounts, e.g., amounts which provide appropriate concentrations for a time sufficient to substantially eliminate or reduce the patient's pathological condition, including stimulating regeneration of damaged or lost hepatic tissue following hepatocellular injury including inhibiting additional damage thereto, to provide therapy for the liver diseases and disorders described above, and amounts effective to protect hepatic tissue in anticipation of injury to the tissue.
  • therapeutically effective amounts e.g., amounts which provide appropriate concentrations for a time sufficient to substantially eliminate or reduce the patient's pathological condition, including stimulating regeneration of damaged or lost hepatic tissue following hepatocellular injury including inhibiting additional damage thereto, to provide therapy for the liver diseases and disorders described above, and amounts effective to protect hepatic tissue in anticipation of injury to the tissue.
  • the concentration of the compounds described in a therapeutic composition will vary depending upon a number of factors, including the dosage of the drug to be administered, the chemical characteristics (e.g., hydrophobicity) of the compounds employed, and the route of administration.
  • the preferred dosage of therapeutic agent to be administered also is likely to depend on such variables as the type and extent of progression of the hepatic disorder, the overall health status of the particular patient, the relative biological efficacy of the compound selected, the formulation of the compound excipients, and its route of administration.
  • the compounds of this invention may be provided in an aqueous physiological buffer solution containing about 0.001 to 10% w/v compound for liquid administration.
  • Typical dose ranges are from about 10 ng/kg to about 1 g/kg of body weight per day; a preferred dose range is from about 0.1 ⁇ g/kg to 100 mg/kg of body weight per day.
  • the morphogen dosage given is between 0.1-100 ⁇ g of protein per kilogram weight of the patient.
  • No obvious morphogen induced pathological lesions are induced when mature morphogen (e.g., OP-1 e.g., (Seq. ID No. 5 or 6, 20 ⁇ g) is administered daily to normal growing rats for 21 consecutive days.
  • 10 ⁇ g systemic injections of morphogen e.g., OP-1; Seq. ID No 5 or 6
  • injected daily for 10 days into normal newborn mice does not produce any gross abnormalties.
  • a large volume loading dose is used at the start of the treatment.
  • the treatment then is continued with a maintenance dose. Further administration then can be determined by monitoring at intervals the levels of the morphogen in the blood.
  • the morphogen preferably is provided just prior to, or concomitant with induction of the trauma.
  • the morphogen is administered prophylactically in a surgical setting.
  • the morphogen dosage given in all cases is between 1-100 ⁇ g of protein per kilogram weight of the patient.
  • an effective amount of an agent capable of stimulating endogenous morphogen levels may be administered by any of the routes described above.
  • an agent capable of stimulating morphogen production and/or secretion from liver tissue cells or from cells at a distant site which then is targeted to the liver may be provided to a mammal.
  • a method for identifying and testing agents capable of modulating the levels of endogenous morphogens in a given tissue is described generally herein in Example 9, and in detail in commonly owned U.S. Ser. No. 07/938,021 filed Aug. 28, 1992 and U.S. Ser. No. 752,859, filed Aug. 30, 1991, both now abandoned, the disclosures of which are incorporated herein by reference.
  • candidate compounds can be identified and tested by incubating the compound in vitro with a test tissue or cells thereof, for a time sufficient to allow the compound to affect the production, i.e., the expression and/or secretion, of a morphogen produced by the cells of that tissue.
  • suitable tissue or cultured cells of a tissue preferably would comprise hepatic tissue cells.
  • a currently preferred detection means for evaluating the level of the morphogen in culture upon exposure to the candidate compound comprises an immunoassay utilizing an antibody or other suitable binding protein capable of reacting specifically with a morphogen and being detected as part of a complex with the morphogen.
  • Immunoassays may be performed using standard techniques known in the art and antibodies raised against a morphogen and specific for that morphogen.
  • Agents capable of stimulating endogenous morphogens then may formulated into pharmaceutical preparations and administered as described herein.
  • Determining the tissue distribution of morphogens may be used to identify different morphogens expressed in a given tissue, as well as to identify new, related morphogens. Tissue distribution also may be used to identify useful morphogen-producing tissue for use in screening and identifying candidate morphogen-stimulating agents.
  • the morphogens (or their mRNA transcripts) readily are identified in different tissues using standard methodologies and minor modifications thereof in tissues where expression may be low. For example, protein distribution may be determined using standard Western blot analysis or immunofluorescent techniques, and antibodies specific to the morphogen or morphogens of interest. Similarly, the distribution of morphogen transcripts may be determined using standard Northern hybridization protocols and transcript-specific probes.
  • any probe capable of hybridizing specifically to a transcript, and distinguishing the transcript of interest from other, related transcripts may be used. Because the morphogens described herein share such high sequence homology in their active, C-terminal domains, the tissue distribution of a specific morphogen transcript may best be determined using a probe specific for the pro region of the immature protein and/or the N-terminal region of the mature protein. Another useful sequence is the 3' non-coding region flanking and immediately following the stop codon. These portions of the sequence vary substantially among the morphogens of this invention, and accordingly, are specific for each protein. For example, a particularly useful Vgr-1-specific probe sequence (e.g., a probe for specific detection of nucleic acid encoding a Seq. ID No.
  • polypeptide 13 polypeptide is the PvuII-SacI fragment, a 265 bp fragment encoding both a portion of the untranslated pro region and the N-terminus of the mature sequence (see Lyons et al. (1989) PNAS 86:4554-4558 for a description of the cDNA sequence).
  • particularly useful mOP-1-specific probe sequences e.g., probe sequences for detecting nucleic acids corresponding to the prodomain sequence in Seq. ID No.
  • BstX1-BglI fragment a 0.68 Kb sequence that covers approximately two-thirds of the mOP-1 pro region; a StuI-StuI fragment, a 0.2 Kb sequence immediately upstream of the 7-cysteine domain; and the Earl-Pst1 fragment, an 0.3 Kb fragment containing a portion of the 3' untranslated sequence.
  • Similar approaches may be used, for example, with hOP-1 (Seq. ID No. 16) or human or mouse OP-2 (Seq. ID Nos. 20 and 22, respectively).
  • morphogen transcripts can be identified in mammalian tissue, using standard methodologies well known to those having ordinary skill in the art. Briefly, total RNA is prepared from various adult murine tissues (e.g., liver, kidney, testis, heart, brain, thymus and stomach) by a standard methodology such as by the method of Chomczyaski et al. ((1987) Anal. Biochem 162:156-159) and described below. Poly (A)+RNA is prepared by using oligo (dT)-cellulose chromatography (e.g., Type 7, from Pharmacia LKB Biotechnology, Inc.).
  • oligo (dT)-cellulose chromatography e.g., Type 7, from Pharmacia LKB Biotechnology, Inc.
  • Poly (A)+RNA (generally 15 ⁇ g) from each tissue is fractionated on a 1% agarose/formaldehyde gel and transferred onto a Nytran membrane (Schleicher & Schuell). Following the transfer, the membrane is baked at 80° C. and the RNA is cross-linked under UV light (generally 30 seconds at 1 mW/cm 2 ). Prior to hybridization, the appropriate probe is denatured by heating. The hybridization is carried out in a lucite cylinder rotating in a roller bottle apparatus at approximately 1 rev/min for approximately 15 hours at 37° C. using a hybridization mix of 40% formamide, 5 ⁇ Denhardts, 5 ⁇ SSPE, and 0.1% SDS. Following hybridization, the non-specific counts are washed off the filters in 0.1 ⁇ SSPE, 0.1% SDS at 50° C.
  • kidney-related tissue appears to be the primary expression source for OP-1 (comprising, e.g., Seq. ID No. 5), with brain, heart and lung tissues being secondary sources.
  • Lung tissue appears to be the primary tissue expression source for Vgr-1, BMP5, BMP4 and BMP3 (comprising respectively, e.g., Seq. ID Nos. 13, 27, 10 and 26)
  • Vgr-1 comprising, a.g., Seq. ID No.
  • GDF-1 (comprising, e.g., Seq. ID No. 14) appears to be expressed primarily in brain tissue.
  • OP-2 (comprising, e.g., Seq. ID No. 7) appears to be expressed primarily in early embryonic tissue. Specifically, northern blots of murine embryos and 6-day post-natal animals shows abundant OP2 expression in 8-day embryos. Expression is reduced significantly in 17-day embryos and is not detected in post-natal animals.
  • mOP-1 e.g., Seq. ID No. 18
  • mOP-1 RNA e.g., RNA complementary to Seq. ID No. 18
  • mOP-1 RNA is expressed significantly in the 15 day embryo, and is present at much lower amounts at later times in healthy hepatic tissue.
  • lanes 2 and 3 contain RNA from 15- and 20-day embryo tissue, lanes 4-8, RNA from 3, 7, 14, 21 and 28 days post natal animals, and lane 8 is a molecular weight ladder.
  • Lanes 1 and 9 are markers.
  • mOP-1 RNA e.g., complementary to Seq. ID No. 18
  • the ability of a morphogen to induce proliferation of primary hepatocytes may be demonstrated in vitro using the following assay using primary hepatocytes isolated from rat liver. Unless otherwise indicated, all chemicals referenced are standard, commercially available reagents, readily available from a number of sources, including Sigma Chemical, Co., St. Louis; Calbiochem, Corp., San Diego, and Aldrich Chemical Co., Milwaukee.
  • Rat primary hepatocyte cultures were prepared by a two-step collagenase digestion essentially as described by Fausto et al. (1987) Cell Separation: Methods and Selected Applications 4:45-77 the disclosure of which is incorporated herein by reference. Briefly, the liver of a male rat (e.g., CD strain, Charles River Laboratories, Wilmington, Mass.) was perfused via the portal vein with Ca 2+ free and Mg 2+ free Hank's balanced salt solution for 10 min at a flow of 30-40 ml/min, followed by perfusion with 0.05% collagenase in Ca 2+ -containing medium (Hepes buffer) for 10 min.
  • Ca 2+ free and Mg 2+ free Hank's balanced salt solution for 10 min at a flow of 30-40 ml/min
  • the liver capsule was removed, the cells shaken loose from the tissue and filtered hepatocytes were collected by repeated centrifugation of the cell suspension at 50 xg for 25 min. Hepatocyte suspensions were virtually free of non-parenchymal cell contamination.
  • Cells (2 ⁇ 10 5 per dish) were plated on 35-mm dishes coated with rat tail collagen in MEM (modified Eagle's Medium, Gibco, Long Island) containing 5% fetal bovine serum (FBS), 1 mM pyuvate, 0.2 mM aspartate, 1 mM proline, 0.2 mM serine, 2 mM glutamine, and 0.5 ⁇ g of hydrocotisone and 1 ⁇ g of insulin per ml.
  • MEM modified Eagle's Medium, Gibco, Long Island
  • FBS fetal bovine serum
  • 1 mM pyuvate 0.2 mM aspartate
  • 1 mM proline 1 mM proline
  • 0.2 mM serine 0.2 m
  • the cell culture then was divided into two groups: (1) wells which received morphogen within the dose range of 1-100 ng of morphogen per ml medium; and (2) the control group, which received no additional factors.
  • OP-1 e.g., Seq. ID No. 5
  • the cells then were incubated for an additional 18-24 hours after which the wells were pulsed with 2 ⁇ Ci/well of 3 H-thymidine and incubated for six more hours. The excess label then was washed off with a cold solution of 0.15 M NaCl. 250 ⁇ l of 10% tricholoracetic acid then was added to each well and the wells incubated at room temperature for 30 minutes.
  • the cells then were washed three times with cold distilled water, and lysed by the addition of 250 ⁇ l of 1% sodium dodecyl sulfate (SDS) for a period of 30 minutes at 37° C.
  • SDS sodium dodecyl sulfate
  • the cell lysates then were harvested using standard means well known in the art, and the incorporation of 3 H-thymidine into cellular DNA was determined by liquid scintillation as an indication of mitogenic activity of the cells.
  • Morphogen treatment of primary hepatocyte cultures significantly stimulates 3 H-thymidine incorporation into DNA, and thus promotes their cell proliferation.
  • the mitogenesis stimulated by 20 ng of OP-1 (e.g., Seq. ID No. 5) in 1 ml serum-free medium was equivalent to the mitogenic effect of 10% fresh serum alone.
  • other local-acting growth factors, such as TGF- ⁇ do not stimulate proliferation of primary hepatocytes (see Fausto et al. (1991) Ciba Found Symp 157:165-174.)
  • liver lobes While hepatocytes have a remarkable capacity to undergo compensatory growth following tissue loss, the reparative properties of liver differ significantly from embryonic morphogenesis. Specifically, following a partial hepatectomy wherein a liver lobe is partially or completely removed, the remaining intact lobes grow rapidly and double in weight due to the ability of the differentiated hepatocytes in the intact lobe to undergo limited proliferation. However, the excised lobe itself is not regenerated.
  • the following example demonstrates the ability of morphogens to regenerate lost hepatic tissue following a partial hepatectomy, including regenerating the excised tissue lobe.
  • the protocol described below is a variation on a standard partial hepatectomy protocol, described, for example, by Higgins et al. (1931) Arch. Pathol. 12:136-202 and Braun et al. (1989) PNAS 86:1558-1562, the disclosures of which are incorporated herein by reference.
  • Morphogen e.g., purified recombinant human OP-1, mature form (Seq. ID No. 5), was solubilized (1 mg/ml) in 50% ethanol (or compatible solvent) containing 0.1% trifluoroacetic acid (or compatible acid).
  • the injectable OP-1 solution was prepared by diluting one volume of OP-1/solvent-acid stock solution with 9 volumes of 0.2% rat serum albumin in sterile PBS (phosphate-buffered saline).
  • FIG. 2 illustrates dramatically the regenerative effects of OP-1 (e.g., Seq. ID No. 5) on liver tissue formation.
  • OP-1 e.g., Seq. ID No. 5
  • the arrow indicates the treated lobe.
  • the OP-1-injected group showed complete liver tissue regeneration including reformation of the excised lobe tissue, and showed no sign of any cut in the liver (animal 2).
  • the excised lobe tissue was not regenerated (animal 1). The original incision remains visible.
  • Hepatic tissue repair following toxic agent-induced damaged tissue involves proliferation and differentiation of hepatocyte precursor cells. This tissue reparation apparently mimics the tissue morphogenesis cascade that occurs during embryogenesis (Fausto, et al.(1989) Lab.Investigation 60:4-13). As demonstrated in the example below, morphogen expression is enhanced significantly during hepatic tissue regeneration following galactosamine or carbon tetrachloride (CCl 4 )-induced liver damage. Experiments were performed essentially as described in Kuhlmann et al., (1980) Virchows Arch 387:47-57, the disclosure of which is incorporated herein by reference .
  • OP-1 expression (e.g., Seq. ID No. 18 expression) was significantly enhanced during this hepatic tissue regenerative period, indicating that morphogens play a significant role in tissue regeneration.
  • lanes 1-8 are samples taken on days 0-7; lane 9 is a sample taken on day 10, and lane 10 contains molecular weight markers.
  • OP-1 mRNA (e.g., complementary to Seq. ID No. 18) shows a significant expression spike on days 3-7.
  • CC1 4 intoxication is induced by orally administering 1.5 g CCl 4 /kg body weight.
  • Significant morphogen expression mOP-1 mRNA, as determined by standard Northern blot is identified by a hybridization spike at 12 hours and continuing through at least 72 hours.
  • the morphogens described herein may be used to alleviate tissue damage associated with immune response-mediated damage to liver tissue. Details of this damage and the use of morphogens to alleviate this injury as well as to provide a cytoprotective effect in anticipation of this injury for example, during a transplant procedure, are disclosed in commonly owned U.S. Ser. No. 07/938,336 and U.S. Ser. No. 07/938,337, both filed Aug. 28, 1992 and now-abandoned, and U.S. Ser. No. 753,059, filed Aug. 30, 1991 (also now abandoned).
  • a primary source of such damage to hepatic tissue results, for example, from reduced perfusion of the hepatic blood supply and/or from partial or complete occlusion of the portal vein.
  • morphogens have been shown to alleviate damage to myocardial tissue following ischemia-reperfusion injury.
  • the morphogens also alleivate analogous tissue damage to hepatic tissue.
  • Morphogens described herein inhibit multinucleation of mononuclear phagocytic cells under conditions where these cells normally would be activated, e.g., in response to a tissue injury or the presence of a foreign substance.
  • an implanted substrate material e.g., implanted subcutaneously
  • a ceramic such as titanium oxide or any other substrate that provokes multinucleated giant cell formation
  • multinucleated giant cells e.g., activated phagocytes stimulated to respond and destroy the foreign object.
  • the recruited cells remain in their mononuclear precursor form and the matrix material is undisturbed.
  • FIG. 5 illustrates this effect of morphogens, in a schematic representation of histology results of a titanium oxide substrate implanted subcutaneously.
  • “mg” means multinucleated giant cells and "ob” means osteoblasts.
  • the substrate represented in FIG. 5B was implanted together with morphogen (OP-1; e.g., Seq. ID No. 5) and newly formed osteoblasts are evident surrounding the substrate.
  • morphogen OP-1; e.g., Seq. ID No. 5
  • the substrate represented in FIG. 5A was implanted without morphogen and extensive multinucleated giant cell formation is evident surrounding the substrate. Accordingly, the morphogens' effect in a mammal also may include inhibiting activation of these giant cells.
  • the morphogens described herein also suppress antibody production stimulated in response to a foreign antigen in a mammal.
  • a standard antibody response to the collagen is stimulated in the rat as determined by standard anti-bovine collagen ELISA experiments performed on blood samples taken at four week intervals following implantation (e.g., between 12 and 20 weeks.)
  • Serum anti-collagen antibody titers measured by ELISA essentially following the procedure described by Nagler-Anderson et al, (1986) PNAS 83:7443-7446, the disclosure of which is incorporated herein by reference, increased consistently throughout the experiment.
  • a morphogen e.g., OP-1 Seq. ID No. 5, dispersed in the matrix and adsorbed thereto, essentially as described in U.S. Pat. No. 4,968,590
  • anti-bovine collagen antibody production was suppressed significantly.
  • This ability of morphogen to suppress the humoral response is further evidence of morphogen utility in alleviating tissue damage.
  • the morphogens described herein induce tissue morphogenesis of damaged or lost tissue.
  • the ability of these proteins to regenerate new tissue also is enhanced by the anti-inflammatory effect of these proteins.
  • Provided below are a series of in vitro experiments demonstrating the ability of morphogens to induce migration and accumulation of mesenchymal cells.
  • the experiments demonstrate that morphogens, unlike TGF- ⁇ , do not stimulate fibrogenesis or scar tissue formation.
  • morphogens do not stimulate production of collagen, hyaluronic acid (HA) or metalloproteinases in primary fibroblasts, all of which are required for fibrogenesis or scar tissue formation.
  • TGF- ⁇ a known inducer of fibrosis, but not of tissue morphogenesis as described herein, does stimulate production of these fibrosis markers.
  • Chemotaxis and migration of mesenchymal progenitor cells were measured in modified Boyden chambers essentially as described by Fava, R.A. et al (1991) J. Exp. Med. 173: 1121-1132, the disclosure of which is incorporated herein by reference, using polycarbonate filters of 2, 3 and 8 micron ports to measure migration of progenitor neutrophils, monocytes and fibroblasts. Chemotaxis was measured over a range of morphogen concentrations, e.g., 10 -20 M to 10 -12 M OP-1 (e.g., Seq. ID No. 5). For progenitor neutrophils and monocytes, 10 -18 -10 -17 M OP-1 (e.g., Seq.
  • HA hyaluronic acid
  • TRIP tissue inhibitor of metalloproteinases
  • fibroblasts were established from explants of infant foreskins and maintained in monolayer culture using standard culturing procedures. (See, for example, (1976) J. Exp. Med. 144: 1188-1203.) Briefly, fibroblasts were grown in maintenance medium consisting of Eagle's MEM, supplemented with nonessential amino acids, ascorbic acid (50 ⁇ g/ml), NaHCO 3 and HEPES buffers (pH 7.2), penicillin (100 U/ml), streptomycin (100 ⁇ g/ml), amphotericin B (1 ⁇ g/ml) and 9% heat inactivated FCS. Fibroblasts used as target cells to measure chemotaxis were maintained in 150 mm diameter glass petri dishes. Fibroblasts used in assays to measure synthesis of collagen, hyaluronic acid, collagenase and tissue inhibitors of metalloproteinases (TIMP) were grown in 100 mm diameter plastic tissue culture petri dishes.
  • TRIP tissue inhibitors of metall
  • fibroblasts were transferred to 24-well tissue culture plates at a density of 8 ⁇ 10 4 cells per well.
  • Fibroblasts were grown to confluency in maintenance medium containing 9% FCS for 72 h and then grown in serum-free maintenance medium for 24 h. Medium was then removed from each well and various concentrations of OP-1 (recombinantly produced mature or soluble form, comprising, e.g., Seq. ID No. 5) or TGF- ⁇ -1 (R&D Systems, Minneapolis) in 50 ⁇ l PBS were added to triplicate wells containing the confluent fibroblast monolayers. For experiments that measured production of collagenase and TIMP, maintenance medium (450 ⁇ l) containing 5% FCS was added to each well, and culture supernatants were harvested from each well 48 h later and stored at -70° C. until assayed.
  • maintenance medium 450 ⁇ l
  • FCS containing 5% FCS was added to each well, and culture supernatants were harvested from each well 48 h later and stored at -70° C. until assayed.
  • OP1 (e.g., Seq. ID No. 5) does not stimulate significant collagen or HA production, as compared with TGF- ⁇ .
  • panel A shows OP-1 (e.g., Seq. ID No. 5) effect on collagen production
  • panel B shows TGF- ⁇ effect on collagen production
  • panels C and D show OP-1 (e.g., Seq. ID No. 5; Panel C) and TGF- ⁇ (panel D) effect on HA production.
  • the morphogen results were the same whether the soluble or mature form of OP1 (comprising, e.g., Seq. ID No. 5) was used.
  • the latent form of TGF- ⁇ (e.g., pro domain-associated form of TGF- ⁇ ) was not active.
  • Morphogen localization in developing and regenerating liver tissue can be used as part of a method for diagnosing a liver function disorder in vivo.
  • the method may be particularly advantageous for diagnosing early stages of a liver dysfunction associated with a hepatocellular injury.
  • a biopsy of liver tissue is performed on a patient at risk, using standard procedures known in the medical art.
  • Morphogen expression associated with the biopsied tissue then is assessed using standard methodologies, as by immunolocalization, using standard immunofluorescence techniques in concert with morphogen-specific antisera or monoclonal antibodies.
  • the biopsied tissue is thin sectioned using standard methodologies known in the art, and fluorescently labelled (or otherwise detectable) antibodies incubated with the tissue under conditions sufficient to allow specific antigen-antibody complex formation. The presence and quantity of complex formed then is detected and compared with a predetermined standard or reference value. Detection of altered levels of morphogen present in the tissue then may be used as an indicator of tissue dysfunction. Alternatively, fluctuation in morphogen levels may be assessed by monitoring morphogen transcription levels, either by standard Northern blot analysis or in situ hybridization, using a labelled probe capable of hybridizing specifically to morphogen RNA and standard RNA hybridization protocols well described in the art and as described in Examples 1, 2, 5 and 6.
  • Fluctuations in morphogen levels present in the bloodstream or peritoneal fluid also may be used to evaluate liver tissue viability.
  • morphogens are detected associated with regenerating liver tissue and/or may be released from dying cells into surrounding peritoneal fluid.
  • OP-1 (comprising, e.g., Seq. ID No. 5) recently has been identified in human blood, which also may be a means of morphogen transport.
  • Serum samples may be obtained by standard venipuncture and serum prepared by centrifugation at 3,000 RPM for ten minutes.
  • peritoneal fluid samples may be obtained by a standard fluid extraction methodology.
  • the presence of morphogen in the serum or peritoneal fluid then may be assessed by standard Western blot (immunoblot), ELISA or RIA procedures.
  • samples may be diluted in an appropriate buffer, such as phosphate-buffered saline, and 50 ⁇ l aliquots allowed to absorb to flat bottomed wells in microtitre plates pre-coated with morphogen-specific antibody, and allowed to incubate for 18 hours at 4° C.
  • Plates then may be washed with a standard buffer and incubated with 50 ⁇ l aliquots of a second morphogen-specific antibody conjugated with a detecting agent, e.g., biotin, in an appropriate buffer, for 90 minutes at room temperature.
  • a detecting agent e.g., biotin
  • a morphogen-specific affinity column may be created using, for example, morphogen-specific antibodies adsorbed to a column matrix, and passing the fluid sample through the matrix to selectively extract the morphogen of interest. The morphogen then is eluted.
  • a suitable elution buffer may be determined empirically by determining appropriate binding and elution conditions first with a control (e.g., purified, recombinantly-produced morphogen.) Fractions then are tested for the presence of the morphogen by standard immunoblot. Morphogen concentrations in serum or other fluid samples then may be determined using standard protein quantification techniques, including by spectrophotometric absorbance or by quantitation by ELISA or RIA antibody assays. Using this procedure, OP-1 (comprising, e.g., Seq. ID No. 5) has been identified in serum.
  • OP-1 (comprising, e.g., Seq. ID No. 5) was detected in human serum using the following assay.
  • activated agarose gel e.g., Affi-GelTM, from Bio-Rad Laboratories, Richmond, Calif., prepared following manufacturer's instructions
  • K-thiocyanante fractions then were dialyzed in 6M urea, 20 mM PO 4 , pH 7.0, applied to a C8 HPLC column, and eluted with a 20 minute, 25-50% acetonitrile/0.1% TFA gradient.
  • OP-1 e.g., Seq. ID No. 5
  • these fractions from the affinity-purified human serum sample were collected and tested for the presence of OP-1 (e.g., Seq. ID No. 5) by standard immunoblot using an OP-1-specifc antibody, and the protein identity confirmed by N-terminal sequencing.
  • Morphogens may be used in diagnostic applications by comparing the quantity of morphogen present in a body fluid sample with a predetermined reference value, with fluctuations in fluid morphogen levels indicating a change in the status of liver tissue.
  • fluctuations in the level of endogenous morphogen antibodies may be detected by this method, most likely in serum, using an antibody or other binding protein capable of interacting specifically with the endogenous morphogen antibody.
  • Detected fluctuations in the levels of the endogenous antibody may be used as indicators of a change in tissue status.
  • Candidate compound(s) which may be administered to affect the level of a given morphogen may be found using the following screening assay, in which the level of morphogen production by a cell type which produces measurable levels of the morphogen is determined with and without incubating the cell in culture with the compound, in order to assess the effects of the compound on the cell's production of morphogen. This can be accomplished by detection of the morphogen either at the protein or RNA level. A more detailed description also may be found in commonly owned, now abandoned U.S. Ser. No. 752,861, incorporated hereinabove by reference.
  • kidneys may be explanted from neonatal or new born or young or adult rodents (mouse or rat) and used in organ culture as whole or sliced (1-4 mm) tissues.
  • Primary tissue cultures and established cell lines, also derived from kidney, adrenals, urinary, bladder, brain, mammary, or other tissues may be established in multiwell plates (6 well or 24 well) according to conventional cell culture techniques, and are cultured in the absence or presence of serum for a period of time (1-7 days).
  • Cells may be cultured, for example, in Dulbecco's Modified Eagle medium (Gibco, Long Island, N.Y.) containing serum (e.g., fetal calf serum at 1%-10%, Gibco) or in serum-deprived medium, as desired, or in defined medium (e.g., containing insulin, transferrin, glucose, albumin, or other growth factors).
  • serum e.g., fetal calf serum at 1%-10%, Gibco
  • serum-deprived medium e.g., fetal calf serum at 1%-10%, Gibco
  • defined medium e.g., containing insulin, transferrin, glucose, albumin, or other growth factors.
  • Samples for testing the level of morphogen production include culture supernatants or cell lysates, collected periodically and evaluated for OP-1 (comprising, e.g., Seq. ID No. 6) production by immunoblot analysis (Sambrook et al., eds., 1989, Molecular Cloning, Cold Spring Harbor Press, Cold Spring Harbor, N.Y.), or a portion of the cell culture itself, collected periodically and used to prepare polyA+ RNA for mRNA analysis.
  • OP-1 comprising, e.g., Seq. ID No.
  • an immunoassay may be performed to detect the morphogen using a polyclonal or monoclonal antibody specific for that protein.
  • OP-1 comprising, e.g., Seq. ID No. 5
  • a polyclonal antibody specific for OP-1 e.g., specific for a Seq. ID No. 5 polypeptide
  • a 100 ⁇ l aliquot of an appropriate dilution of each of the test samples of cell culture supernatant is added to each well in triplicate and incubated at 37° C. for 30 min. After incubation, 100 ⁇ l biotinylated rabbit anti-OP-1 (e.g., Anti-Seq. ID No. 5) serum (stock solution is about 1 mg/ml and diluted 1:400 in BSB containing 1% BSA before use) is added to each well and incubated at 37° C. for 30 min. The wells are then washed four times with BSB containing 0.1% Tween 20. 100 ⁇ l strepavidin-alkaline (Southern Biotechnology Associates, Inc.
  • Polyclonal antibody may be prepared as follows. Each rabbit is given a primary immunization of 100 ug/500 ⁇ l E. coli produced OP-1 monomer (having an amino acid sequence of residues 328-431 in SEQ ID NO:17) in 0.1% SDS mixed with 500 ⁇ l Complete Freund's Adjuvant. The antigen is injected subcutaneously at multiple sites on the back and flanks of the animal. The rabbit is boosted after a month in the same manner using incomplete Freund's Adjuvant. Test bleeds are taken from the ear vein seven days later. Two additional boosts and test bleeds are performed at monthly intervals until antibody against OP-1 (e.g., against the Seq. ID No. 17 polypeptide) is detected in the serum using an ELISA assay. Then, the rabbit is boosted monthly with 100 ⁇ g of antigen and bled (15 ml per bleed) at days seven and ten after boosting.
  • OP-1 e.g., against the Seq. ID No. 17
  • Monoclonal antibody specific for a given morphogen may be prepared as follows. A mouse is given two injections of E. coli produced OP-1 (e.g., Seq. ID No. 17) monomer. The first injection contains 100 ⁇ g of OP-1 in complete Freund's adjuvant and is given subcutaneously. The second injection contains 50 ⁇ g of OP-1 in incomplete adjuvant and is given intraperitoneally. The mouse then receives a total of 230 ⁇ g of OP-1 polypeptide (having the amino acid sequence of residues 307-431 in SEQ ID NO:17) in four intraperitoneal injections at various times over an eight month period.
  • OP-1 e.g., Seq. ID No. 17
  • the mouse is boosted intraperitoneally with 100 ⁇ g of OP-1 (Seq. ID No. 17, residues 307-431) and 30 ⁇ g of the N-terminal peptide (Ser 293 -Asn 309 -Cys) conjugated through the added cysteine to bovine serum albumin with SMCC crosslinking agent.
  • This boost was repeated five days (IP), four days (IP), three days (IP) and one day (IV) prior to fusion.
  • mice spleen cells are then fused to myeloma (e.g., 653) cells at a ratio of 1:1 using PEG 1500 (Boeringer Mannheim), and the cell fusion is plated and screened for OP-1-specific antibodies using OP-1 (307-431) as antigen.
  • the cell fusion and monoclonal screening then are according to standard procedures well described in standard texts widely available in the art.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Oral & Maxillofacial Surgery (AREA)
  • Molecular Biology (AREA)
  • Transplantation (AREA)
  • Genetics & Genomics (AREA)
  • Dermatology (AREA)
  • Biochemistry (AREA)
  • Immunology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Toxicology (AREA)
  • Dentistry (AREA)
  • Wood Science & Technology (AREA)
  • Environmental Sciences (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Disclosed are therapeutic treatment methods, compositions and devices for maintaining liver function in a mammal, including methods, compositions and devices for regenerating lost or damaged hepatic tisse, enhancing viability and integration of hepatic tissue and organ transplants, and correcting liver function deficiencies. The methods, compositions and devices on this invention all provide a therapeutically effective morphogen concentration to the hepatic cells to be treated.

Description

CROSS REFERENCE TO RELATED APPLICATIONS
This is a continuation of U.S. Ser.No. 08/165,541, filed Dec. 9, 1993 (now abandoned) which is a continuation of U.S. Ser. No. 07/946,238, filed on Sep. 16, 1992 (now abandoned). Prior U.S. Ser.No. 07/946,238 was a continuation-in-part of (1) U.S. Ser .No. 07/752,764, filed Aug. 30, 1991 (now abandoned), which was a continuation-in-part of U.S. Ser.No. 07/667,274, filed Mar. 11, 1991 (now abandoned); (2) U.S. Ser. No. 07/938,336, filed Aug. 28, 1992 (now abandoned) and (3) U.S. Ser. No. 07/938,337, filed Aug. 28, 1992 (now abandoned). U.S. Ser. No. 07/937,337 was a continuation-in-part of U.S. Ser. No. 07/753,059, filed Aug. 30, 1991, (now abandoned), which was a continuation-in-part of abandoned U.S. Ser. No. 07/667,274, filed Mar. 11, 1991 (now abandoned) Ths disclosures of each of the aforementioned applications are incorporated herein by reference.
FIELD OF THE INVENTION
The present invention relates generally to liver treatment methods.
BACKGROUND OF THE INVENTION
The present invention relates to methods and compositions for regenerating lost or damaged liver tissue in vivo and to methods and compositions for maintaining normal liver function which may be reduced or lost as a result of such tissue damage. The invention further relates to methods and compositions for correcting one or more liver function deficiencies in a mammal, particularly a human.
The liver is the largest visceral organ in the body and consists of two main lobes, a larger right lobe and a smaller left lobe. The right lobe also contains two smaller segments referred to as the cuadata and quadrata lobes. The liver has a dual blood supply, consisting of the hepatic artery and the portal vein. The hepatic lymphatics drain principally into lymph nodes of the porta hepatis and celiac axis.
The liver is responsible for a wide variety of functions, broadly characterized as metabolic, storage, synthetic, catabolic and excretory. Specifically, the liver is the central organ of glucose homeostasis, responsible for both storing excess blood glucose as glycogen and restoring blood glucose by glycogenolysis and gluconeogenesis and by converting free fatty acids to triglycerides and lipoproteins. The liver also stores triglycerides, iron, copper and lipid-soluble vitamins and synthesizes many of the binding proteins for iron, copper and Vitamin A.
In addition, most serum proteins, with the exception of immunoglobulins, are synthesized in the liver, including albumin, the principal source of plasma osmotic pressure, blood clotting factors such as prothrombin, fibrinogen and Factor VIII, as well as complement and other acute phase reactants involved in an immune response. The liver also functions as a catabolic site for hormones, serum proteins, and other endogenous proteins, as well as acting as the detoxification site for foreign compounds, including drugs (pharmaceuticals), industrial chemicals, environmental contaminants, and various bacterial metabolism byproducts. Finally, the liver excretes bile, which provides a repository for the products of hemecatabolism and also is vital for fat absorption in the small intestine.
Not surprisingly, liver function disorders, whether resulting from a particular protein deficiency or from hepatic tissue damage and/or loss, has serious and far-reaching consequences. For example, reduced albumin levels in chronic liver disease contribute to the development of edema and ascites; liver failure also is characterized by severe and often life-threatening bleeding, due to the reduced production of essential blood clotting factors. Hepatic failure also can induce neurological dysfunction, characterized broadly as hepatic encephalopathy, as well as associated renal failure, jaundice, pulmonary complications, and a host of disorders associated with hormonal imbalances.
Unlike most other organs in the body the liver has a defined regenerative capacity following hepatic tissue damage or cell death. Specifically, while hepatocytes do not proliferate actively following fetal and post natal liver growth, normally quiescent hepatocytes do divide in response to cell death or loss of liver tissue. However, where tissue damage is extensive and/or chronic, permanent tissue damage can result, reducing the organ's viability and functional capacity. Permanent hepatic tissue damage typically is characterized by extensive necrosis and/or fibrogenesis or scarring (cirrhosis). Another source of nonreparative damage results from hepatic neoplasms and metastatic carcinomas.
Where either the mass of liver cells is sufficiently diminished or their function sufficiently impaired, hepatic failure ensues. The etiology of hepatic failure may be metabolic (e.g., altered bilirubin metabolism or fatty acid storage), infectious (e.g., induced by viral hepatitis, hepatic schistomiasis, syphilis, or ascariaris), toxic (e.g., induced by ethanol, ammonia, phenol, and other environmental toxins, fatty acids, drugs and/or their metabolites), autoimmune, ischemic or nutritional (e.g., alcoholic liver disease).
Another source of hepatic failure results from malignant tumors. The tumor cells may be derived from hepatic tissue cells (as in hepatocellular carcinoma, bileduct carcinomas, hepatoblastomas or hemangiosarcoma) or may be derived from distant tissue as part of a metastatic cancer. In fact, metastatic cancers are by far the most common malignant neoplasms of the liver, most notably derived from cancers of the gastrointestinal tract, breast and lung.
Another source of diminished liver function arises from hepatic protein deficiencies, which may result from a genetic defect (so called "inborn errors of metabolism") or may be induced by, for example, a pharmaceutical, infectious agent byproduct, or the like. For example, hemophilia is believed to be associated with diminished Factor VIII production. Similarly, Wilson's disease, a copper metabolism disorder, is associated with deficient ceruloplasmin production by the liver. Altered production of albumin in the liver affects bilirubin metabolism. Deficiency of α1 -antitrypsin, also normally produced in the liver, can result in fatal neonatal hepatitis.
To date, the only viable treatment for hepatic failure or for patients at risk for hepatic failure due to, for example, chronic acute hepatitis, biliary atresia, idiopathic cirrhosis, primary biliary cirrhosis, sclerosing cholangitis, inborn errors of metabolism or malignancy, is liver transplantation. To date, liver transplantation also is the only viable alternative for correcting significant liver function deficiencies that result from inborn errors of metabolism. Liver transplantation as a treatment method suffers from donor scarcity, particularly of pediatric livers, technical surgical complexity, postoperative complications including organ rejection, and continuing difficulties in maintaining organ viability throughout the transplant process.
Selective cell transplantation of only those parenchymal elements necessary to replace lost function has been proposed as an alternative to whole or partial organ transplantation that avoid major surgery with its attendant blood loss, anesthetic difficulties, and complications (P. S.Russell, Ann. Surg. 201(3), 255-262 (1985). Replacing only those cells which supply the needed function reduces problems with passenger leukocytes, antigen presenting cells, and other cell types which may promote the rejection process. The ability to expand cell numbers with proliferation of cells in culture, in theory, allows autotransplantation of one's own tissue. In addition, transplantable cells may be used as part of a gene therapy to correct a liver protein deficiency, and/or as in vivo drug delivery vehicles. WO88/03785 published Jun. 2, 1988, and WO90/12640 published Nov. 1, 1990, both describe methods for attaching hepatocytes to matrices and implanting the matrices at sites in vivo that are capable of providing the cells with adequate nutrition or gas exchange, such as within mesentery folds or the odentum. To date, the existing protocols suffer from a variety of limitations. Typically, partial hepatectomy is required to stimulate cell proliferation of the synthetic tissue in vivo. In addition, cell implantation typically is accompanied by significant cell loss, requiring a substantial seed cell population for implantation, which may further require lengthy in vitro incubation periods. The delay in in vivo integration of the implanted cell-matrix structure also places significant restrictions on the matrix scaffold composition. Finally, the implanted cell-matrix structures also are at risk for destruction by the implant host's immune response mechanisms.
It is an object of this invention to provide methods and compositions for regenerating lost or damaged hepatic tissue in vivo in an existing liver without requiring organ or tissue transplant. Another object is to provide means for maintaining normal liver function following hepatic tissue injury or in anticipation of such injury. Another object is to provide means for enhancing or increasing a depressed liver function level which may result from a tissue injury or disease. Still another object is to provide methods and compositions for correcting a liver function deficiency in a mammal. Yet another object is to provide gene therapy protocols and compositions useful for correcting a protein deficiency in a mammal. Yet another object is to enhance integration of a liver tissue implant. These and other objects and features of the invention will be apparent from the description, drawings and claims which follow.
SUMMARY OF THE INVENTION
The present invention provides methods and compositions for maintaining liver function in a mammal. The invention provides means for correcting one or more liver function deficiencies in a mammal that may arise, for example, from an inborn metabolism defect, and means for regenerating lost or damaged hepatic tissue in a mammal, including means for protecting the tissue from damage thereto. The invention also provides means for enhancing the viability of a hepatic tissue or organ to be transplanted and means for enhancing the integration of the transplanted tissue. The methods and compositions of this invention include providing to hepatic cells a therapeutically effective concentration of a morphogenic protein ("morphogen", as defined herein) upon hepatocellular injury, or in anticipation of such injury, or following diagnosis of a liver function defect in a mammal, for a time and at a concentration sufficient to maintain or regain liver function in vivo.
In one aspect, the invention features compositions and therapeutic treatment methods that include administering to a mammal a therapeutically effective amount of a morphogenic protein ("morphogen"), as defined herein, upon hepatocellular injury, or in anticipation of such injury, or following diagnosis of a liver function deficiency, for a time and at a concentration sufficient to maintain normal and/or to regain lost liver function in vivo, including regenerating lost or damaged hepatic tissue, and/or inhibiting additional damage thereto. The morphogens described herein also are capable of enhancing the level of a liver function which may be depressed as a result of a tissue injury or disease.
In another aspect, the invention features compositions and therapeutic treatment methods for maintaining liver function in a mammal in vivo which include administering to the mammal, upon hepatocellular injury or in anticipation of such injury, or following diagnosis of a liver function deficiency, a compound that stimulates in vivo a therapeutically effective concentration of an endogenous morphogen within the body of the mammal sufficient to increase or enhance the level of a depressed liver function, and/or to maintain normal and/or regain lost liver function, including regenerating damaged or lost hepatic tissue and/or inhibiting additional damage thereto. These compounds are referred to herein as morphogen-stimulating agents, and are understood to include substances which, when administered to a mammal, act on cells of tissue(s) or organ(s) that normally are responsible for, or capable of, producing a morphogen and/or secreting a morphogen, and which cause the endogenous level of the morphogen to be altered. The agent may act, for example, by stimulating expression and/or secretion of an endogenous morphogen.
While the methods and compositions described herein are particularly related to liver organ therapies, as will be appreciated by those skilled in the art, and as described in the now abaondoned parents of the instant application, including U.S.Ser. No. 667,274, U.S. Ser. No. 752,764, U.S. Ser. No. 753,059, U.S. Ser. No. 07/938,336 and U.S. Ser. No. 07/938,337, the methods and compositions of this invention can be applied, without undue experimentation, to other organ applications, including but not limited to, the pancreas, lung, kidney and heart. Accordingly, the methods and compositions disclosed herein can be used to advantage in the repair, regeneration, transplantation and/or function level enhancement of damaged or lost tissue such as, for example, damaged lung tissue resulting from emphysema, cirrhotic kidney or pancreatic tissue, damaged heart or blood vessel tissue, as may result from cardiomyopathies and/or atherothrombotic or cardioembolic strokes, damaged stomach tissue resulting from ulceric perforations or their repair, damaged neural tissue as may result from physical injury, degenerative diseases such as Alzheimer's disease or multiple sclerosis or strokes, and damaged dental and/or periodental tissue as may result from disease or mechanical injury. The methods and compositions also may be used to protect these tissues from anticipated injury, including unavoidably or deliberately induced injury, as may occur in a surgical or other clinical procedure. In addition to the tissue regenerative properties provided herein, the gene therapy and drug delivery protocols described herein may be used to particular advantage in pancreatic tissue, renal tissue and lung tissue contexts.
As embodied herein, the expression "maintaining normal liver function" means both regaining or restoring liver function lost due to a hepatocellular injury or inborn metabolic defect, as well as protecting the hepatic tissue at risk of damage from hepatocellular injury. "Depressed liver function" level refers to a diminished or deficient liver function as a result of a tissue injury or disease. The expression "enhance viability of" transplant hepatic tissue or organ, as used herein, means protection from, reduction of and/or elimination of reduced or lost tissue or organ function as a result of tissue necrosis and/or fibrosis associated with transplantation, particularly immune response-mediated tissue necrosis and/or fibrosis. "Alleviating" means protection from, reduction of and/or elimination of undesired tissue destruction, particularly immune response-mediated tissue destruction. "Transplanted" living tissue includes both tissue grafts and cellular transplants, as in the case of transplanted isolated progenitor or stem cells, for example, which may be implanted alone or in association with a temporary scaffolding. Tissues may be autologous or allogenic tissue and/or synthetic tissue created, for example, by culturing hepatic cells in the presence of an artificial matrix. "Morphogenically permissive environment" is understood to mean an environment competent to allow tissue morphogenesis to occur. Finally, "symptom alleviating cofactor" refers to one or more pharmaceuticals which may be administered together with the therapeutic agents of this invention and which alleviate or mitigate one or more of the symptoms typically associated with liver tissue and/or liver function loss. Exemplary cofactors include antibiotics, antiseptics, non-steroidal anti-inflammatory agents, and the like.
In one aspect of the invention, the methods and compositions of this invention are useful in the replacement of diseased, damaged or lost hepatic tissue in a mammal, particularly when the damaged tissue interferes with normal tissue or organ function. Where hepatic tissue has been lost, remaining hepatocytes are capable only of compensatory cell division to return the organ volume essentially to its original size. As determined by extensive experimental partial hepatectomy studies wherein part of all of a liver lobe is excised, this compensatory growth does not involve true morphogenisis, and the lost tissue is not itself regenerated. Rather, the intact lobe is capable only of tissue augmentation to compensate for the lost mass. By contrast, recent studies on toxin-induced tissue damage does suggest that this repair involves morphogenesis, particularly the infiltration and proliferation of progenitor cells. As described in Example 3 and 4, below, endogenous morphogen expression is enhanced following toxin-induced hepatic tissue damage, and not following partial hepatectomy.
When the proteins described herein are provided to, or their expression stimulated at, a hepatic tissue locus, the developmental cascade of tissue morphogenesis is induced, capable of stimulating the migration, proliferation and differentiation of hepatic progenitor cells, to regenerate viable hepatic tissue, including inducing the necessary associated vascularization (see below). Thus, in one embodiment the invention provides methods and compositions for regenerating lost or substantially irreparably damaged hepatic tissue. The morphogen preferably is provided directly to the locus of tissue regeneration, e.g., by injection of the morphogen dispersed in a biocompatible, injectable solution, or by topical administration, as by painting or spraying a morphogen-containing solution on the tissue. Preferably, the locus has been surgically prepared by removing existing necrotic or cirrhotic tissue. Alternatively, morphogen may be provided locally by means of an osmotic pump implanted in the peritoneal cavity. At least one morphogen (OP-1, comprising e.g. Seq. ID No. 5) is known to be expressed by hepatic tissue during liver formation. Accordingly, in the alternative, and/or in addition, an agent capable of stimulating expression and/or secretion of an endogenous morphogen may be administered. As yet another alternative, progenitor hepatocytic cells may be stimulated ex vivo by exposure to a morphogen or morphogen-stimulating agent, and the stimulated cells, now primed for proliferation and differentiation, then provided to the hepatic tissue locus. A morphogen or a morphogen-stimulating agent also may be implanted with the cells. Alternatively, a suitable local morphogen concentration may be maintained by means of, for example, an osmotic pump. In all these cases the existing tissue provides the necessary matrix requirements, providing a suitable substratum for the proliferating and differentiating cells in a morphogenically permissive environment, as well as providing the necessary signals for directing the tissue-specificity of the developing tissue.
When the morphogens (or progenitor cells stimulated by these morphogens) are provided at a tissue-specific locus (e.g., by systemic injection or by implantation or injection at a tissue-specific locus, or by administration of an agent capable of stimulating morphogen expression in vivo), the existing tissue at that locus, whether diseased or damaged, has the capacity of acting as a suitable matrix. Alternatively, a formulated matrix may be externally provided together with the stimulated progenitor cells or morphogen, as may be necessary when the extent of injury sustained by the damaged tissue is large. The matrix should be a biocompatible, suitably modified acellular matrix having dimensions such that it allows the influx, differentiation, and proliferation of migratory progenitor cells, and is capable of providing a morphogenically permissive environment (see infra). Currently preferred matrices also are biodegradable. Where morphogen and/or progenitor cells are to be implanted and the existing liver tissue is insufficient to provide the necessary matrix components, the formulated matrix preferably is tissue-specific.
Formulated matrices may be generated from a fibrin clot or dehydrated organ-specific tissue, prepared for example, by treating the tissue with solvents to substantially remove the non-structural components from the tissue. Alternatively, the matrix may be formulated synthetically using one or more biocompatible, preferably in vivo biodegradable, structural carrier materials such as collagen, laminin, and/or hyaluronic acid which also may be in association with suitable tissue-specific cell attachment factors. Other biocompatible, in vivo biodegradable components, including synthetic polymers, including polybutyric, polylactic, polyglycolic acids, polyanhydrides and/or copolymers thereof. Currently preferred structural materials contain collagens. Currently preferred cell attachment factors include glycosaminoglycans and proteoglycans. The matrix further may be treated with an agent or agents to increase the number of pores and/or micropits on its surfaces, so as to enhance the influx, proliferation and differentiation of migratory progenitor cells from the body of the mammal.
In many instances, the loss of hepatic tissue function results from fibrosis or scar tissue formation, formed in response to an initial or repeated injury to the tissue. The degree of scar tissue formation generally depends on the regenerative properties of the injured tissue, and on the degree and type of injury. In liver, repeated tissue damage results in liver cirrhosis which destroys normal hepatic architecture by fiberous septa, causing vascular disorganization and perfusion deficits that impair liver function and unchecked, lead to hepatic failure. Thus, in another aspect, the invention provides methods and compositions that may be used to prevent and/or substantially inhibit the formation of scar tissue in hepatic tissue by providing the morphogens, or morphogen-stimulated cells, to a newly injured tissue locus (see below).
The morphogens of this invention also may be used to increase or regenerate a liver progenitor or stem cell population in a mammal. For example, progenitor cells may be isolated from an individual's bone marrow, stimulated ex vivo for a time and at a morphogen concentration sufficient to induce the cells to proliferate, and returned to the bone marrow. Other sources of progenitor cells that may be suitable include biocompatible cells obtained from a cultured cell line, stimulated in culture, and subsequently provided to the body. Alternatively, the morphogen may be provided systemically, or implanted, injected or otherwise provided to a progenitor cell population in an individual to induce its mitogenic activity in vivo. For example, an agent capable of stimulating morphogen expression in the progenitor cell population of interest may be provided to the cells in vivo, for example systemically, to induce mitogenic activity.
In still another aspect of the invention, the morphogens also may be used to support the growth and maintenance of differentiated cells, inducing existing differentiated cells to continue expressing their phenotype. It is anticipated that this activity will be particularly useful in the treatment of liver disorders where loss of liver function is caused by cells becoming metabolically senescent or quiescent. Application of the protein directly to the cells to be treated, or providing it by systemic injection, can be used to stimulate these cells to continue expressing their phenotype, thereby significantly reversing the effects of the dysfunction. Alternatively, administration of an agent capable of stimulating morphogen expression in vivo also may be used. In addition, the morphogens of this invention also may be used in gene therapy protocols to stimulate the growth of quiescent cells, thereby potentially enhancing the ability of these cells to incorporate exogenous DNA.
In another aspect of the invention, the method disclosed is useful for redifferentiating transformed cells, particularly transformed cells of parenchymal origin, such that the morphogen-treated cells are induced to display a morphology characteristic of untransformed cells. As specifications of now-abandoned parent applications described in the U.S. Ser. No 752,764 and USSN 922,813, filed Aug. 28, 1992 and incorporated herein by reference, the morphogens previously have been found to induce redifferentiation of transformed embryonic cells and cells of neuronal origin to a morphology characteristic of untransformed cells. Morphogen treatment preferably induces cell rounding and cell aggregation (clumping), cell-cell adhesion, and CAM production. The methods described herein are anticipated to substantially inhibit or reduce hepatocytic cell tumor formation and/or proliferation in liver tissue. It is anticipated that the methods of this invention will be useful in substantially reducing the effects of various carcinomas and sarcomas of liver tissue origin, including hepatocellular carcinomas, bileduct carcinomas, hepatoblastomas, and hemangiosarcomas. In addition, the method also is anticipated to aid in inhibiting neoplastic lesions caused by metastatic tissue. Metastatic tumors are one of the most common neoplasms of the liver, as they can reaching the liver through the bloodstream or lymph nodes. Metastatic tumors may damage hepatic function for example, by distorting normal liver tissue architecture, blocking or inhibiting blood flow, and/or by stimulating the body's immune response.
In another aspect of the invention, the morphogens described herein are useful for providing hepatocellular protective effects to alleviate liver tissue damage associated with the body's immune/inflammatory response to an initial injury to the tissue. As described in detail in abandoned parent applications U.S. Ser. No. 07/753,059, U.S. Ser. No. 07/938,336 and 07/938,337 such a response may follow acute or chronic trauma to hepatic tissue, caused, for example, by an autoimmune dysfunction, neoplastic lesion, infection, chemical or mechanical trauma, disease or by partial or complete interruption of blood flow to hepatocytes, for example following ischemia or hypoxia, or by other trauma to the liver or surrounding material. For example, portal hypertension is a significant liver disease caused by reduced blood flow through the portal vein and is characterized by tissue necrosis and cirrhosis. Application of the morphogen directly to the cells to be treated, or providing the morphogen to the mammal systemically, for example, intravenously or indirectly by oral administration, may be used to alleviate and/or inhibit the immunologically related response to a hepatic tissue injury. Alternatively, administration of an agent capable of stimulating morphogen expression and/or secretion in vivo, preferably at the site of injury, also may be used. Where the injury is to be unavoidably or deliberately induced, as during surgery or other aggressive clinical treatment, the morphogen or agent may be provided prior to induction of the injury to provide a cytoprotective effect to the liver tissue at risk.
Similarly, hepatic tissues and organs for transplantation also are subject to the tissue destructive effects associated with the recipient host body's inflammatory response following transplantation. It is currently believed that the initial destructive response is due in large part to reperfusion injury to the transplanted organ after it has been transplanted to the organ recipient.
Accordingly, the success of liver or hepatic tissue transplantation depends greatly on the preservation of the tissue activity (e.g., tissue or organ viability) at the harvest of the organ, during storage of the harvested organ, and at transplantation. To date, preservation of organs such as lungs, pancreas, heart and liver remains a significant stumbling block to the successful transplantation of these organs. U.S. Pat. No. 4,952,409 describes a superoxide dismutase-containing liposome to inhibit reperfusion injury. U.S. Pat. No. 5,002,965 describes the use of ginkolides, known platelet activating factor antagonists, to inhibit reperfusion injury. Both of these factors are described as working primarily by inhibiting the release of and/or inhibiting the damaging effects of free oxygen radicals. A number of patents also have issued on the use of immunosuppressants for inhibiting graft rejection. A representative listing includes U.S. Pat. Nos. 5,104,858, 5,008,246 and 5,068,323. A significant problem with many immunosuppressants is their low therapeutic index, requiring the administration of high doses that can have significant toxic side effects.
Thus, in another aspect of the invention, where a partial or complete organ transplant is desired, the morphogen may be administered to transplant tissue to enhance the viability of the tissue, to alleviate the tissue damage associated with immune response-mediated tissue destruction and/or to provide a cytoprotective effect to tissue at risk for such damage. Exemplary transplant tissues include hepatic tissue grafts which may be allogenic, autologous and/or synthetic (e.g., cultured cells attached to an artificial matrix), and whole or partial livers. Where the transplant tissue (e.g., liver, lung, kidney, pancreas, heart, etc.) is to be harvested from a donor host, the morphogen also preferably is provided to the tissue prior to, or concomitant with the tissue harvest, e.g., as a prophylactic, to provide a cytoprotective effect to the tissue.
In another aspect of the invention, the morphogens described herein also may be used in a gene therapy protocol and/or as part of a drug delivery protocol to correct a protein deficiency in a mammal, resulting, for example, from a genetic disorder or other dysfunction to the protein-producing tissue. Specifically, the methods and compositions of this invention are contemplated for use in providing to the mammal an in vivo protein-producing mechanism for correcting any protein deficiency in the mammal. These proteins include proteins normally expressed and/or secreted by hepatic tissue and which play a role in liver-related functions, proteins normally expressed and secreted by the liver and which function elsewhere in the body, and proteins not normally expressed by hepatic tissue. Cells competent for expressing one or more proteins necessary to overcome the protein deficiency in vivo may be stimulated to proliferate ex vivo, and then implanted at a morphogenically permissive site at a liver-specific tissue locus in vivo. The competent cells may be attached to a scaffold-like structure prior to implantation. Alternatively, the competent cells may be attached to a synthetic or formulated matrix and implanted together with a morphogen at an extra-hepatic site in vivo, such as within the folds of the mesentery, or other associated vascularized tissue locus capable of providing the necessary nutrients and gas exchange to the cells. A detailed description of useful extra-hepatic loci are described, for example, in WO90/12604, published Nov. 1, 1990 to Vacanti et al., the disclosure of which is incorporated herein by reference. Exposing primary hepatocytes to a morphogen stimulates their proliferation (see below), thereby enhancing their cellular viability upon implantation, accelerating tissue development, and reducing the original cell population required to seed the matrix. In addition, implantation with a morphogen eliminates the need for partial hepatectomy to stimulate proliferation, and enhances cellular viability by inhibiting the inflammatory/immune response typically associated with such a procedure, overcoming the significant hepatocyte cell loss typically seen in this procedure.
Cells competent for correcting a protein deficiency include allogenic primary hepatocytes, preferably from a serotypically compatible individual and competent for expressing the protein or proteins of interest, and autologous cells transfected with the genetic material necessary to express the protein of interest. For example, primary hepatocytes may be removed from the patient by biopsy, transfected using standard recombinant DNA technology, proliferated, attached to a matrix and reimplanted together with a morphogen. Preferably the morphogen is provided to the cells during transfection and proliferation to enhance the mitogenic activity (and nucleic acid uptake) of these cells. In a currently preferred embodiment, morphogen is adsorbed to the matrix surface to which the cells are attached and the complex implanted as a single entity ("cell-matrix structure".)
In any treatment method of the invention, "administration of morphogen" refers to the administration of the morphogen, either alone or in combination with other molecules. For example, the mature form of the morphogen may be provided in association with its precursor "pro" domain, which is known to enhance the solubility of the protein. Alternatively, the pro form of the morphogen (e.g., defined, for example, by amino acid residues 30-431 of OP1, Seq. I.D. No. 16, see below) may be used. Other useful molecules known to enhance protein solubility include casein and other milk components, as well as various serum proteins. Additional useful molecules which may be associated with the morphogen or morphogen-stimulating agent include tissue targeting molecules capable of directing the morphogen or morphogen-stimulating agent to hepatic tissue. Tissue targeting molecules envisioned to be useful in the treatment protocols of this invention include antibodies, antibody fragments or other binding proteins which interact specifically with surface molecules on nerve tissue cells. Still another useful tissue targeting molecule may include part or all of the morphogen precursor "pro" domain.
Associated tissue targeting or solubility-enhancing molecules also may be covalently linked to the morphogen using standard chemical means, including acid-labile linkages, which likely will be preferentially cleaved in the acidic environment of bone remodeling sites.
The morphogens and morphogen-stimulating agents also may be provided to the liver tissue together with other molecules ("cofactors") known to have a beneficial effect in treating damaged hepatic tissue, particularly cofactors capable of mitigating or alleviating symptoms typically associated with hepatic tissue damage and/or loss. Examples of such cofactors include antiseptics, antibiotics, tetracycline, aminoglycosides, macrolides, penicillins and cephalosporins, and other, non-steroidal anti-inflammatory agents.
Among the morphogens useful in this invention are proteins originally identified as osteogenic proteins, such as the OP-1 (comprising, e.g., the sequence shown in Seq. ID No. 5 or 6), OP-2 (comprising, e.g., the sequence shown in Seq. ID No. 7 or 8) and CBMP2 (comprising, e.g., the sequence shown in Seq. ID No. 9 or 10) proteins, as well as amino acid sequence-related proteins such as DPP (from Drosophila; comprising, e.g., the sequence shown in Seq. ID No. 11, Vgl (from Xenopus; comprising, e.g., the sequence shown in Seq. ID No. 12), Vgr-1 (from mouse; comprising, e.g., the sequence shown in Seq. ID No. 13, see U.S. Pat. No. 5,011,691 to Oppermann et al.), GDF-1 (from mouse; comprising, e.g., the sequence shown in Seq. ID No. 14, see Lee (1991) PNAS 88:4250-4254), all of which are presented in Table), and the recently identified 60A protein (from Drosophila comprising, e.g., the sequence shown in, Seq. ID No. 24, see Wharton et al. (1991) PNAS 88:9214-9218). The members of this family, which include members of the TGF-β super-family of proteins, share substantial amino acid sequence homology in their C-terminal regions. The proteins are translated as a precursor, having an N-terminal signal peptide sequence, typically less than about 30 residues, followed by a "pro" domain that is cleaved to yield the mature sequence. The "pro" form of the protein, includes both the pro domain and the mature domain, and forms a soluble species that apprears to be the primary form secreted from cultured mammalian cells. The signal peptide is cleaved rapidly upon translation, at a cleavage site that can be predicted in a given sequence using the method of Von Heijne ((1986) Nucleic Acids Research 14:4683-4691). Table I, below, describes the various morphogens identified to date, including their nomenclature as used herein, their Seq. ID references, and publication sources for the amino acid sequences for the full length proteins not included in the Seq. Listing. The disclosure of these publications is incorporated herein by reference.
              TABLE I                                                     
______________________________________                                    
"OP-1"     Refers generically to the group of                             
           morphogenically active proteins expressed                      
           from part or all of a DNA sequence                             
           encoding OP-1 protein, including allelic                       
           and species variants thereof, e.g., human                      
           OP-1 ("hOP-1", Seq. ID No. 5, mature                           
           protein amino acid sequence), or mouse                         
           OP-1 ("mOP-1", Seq. ID No. 6, mature                           
           protein amino acid sequence.) The                              
           conserved seven cysteine skeleton is                           
           defined by residues 38 to 139 of Seq. ID                       
           Nos. 5 and 6. The cDNA sequences and the                       
           amino acids encoding the full length                           
           proteins are provided in Seq. Id Nos. 16                       
           and 17 (hOP1) and Seq. ID Nos. 18 and 19                       
           (mOP1.) The mature proteins are defined                        
           by residues 293-431 of Seq. ID No. 17                          
           (hOP1) and 292-430 of Seq. ID. 19                              
           (mOP1). The "pro" regions of the                               
           proteins, cleaved to yield the mature,                         
           morphogenically active proteins are                            
           defined essentially by residues 30-292                         
           of Seq. ID No. 17 (hOPl) and residues                          
           30-291 of Seq. ID No. 10 (mOP1).                               
"OP-2"     refers generically to the group of active                      
           proteins expressed from part or all of a                       
           DNA sequence encoding OP-2 protein,                            
           including allelic and species variants                         
           thereof, e.g., human OP-2 ("hOP-2", Seq.                       
           ID No. 7, mature protein amino acid                            
           sequence) or mouse OP-2 ("mOP-2", Seq. ID                      
           No. 8, mature protein amino acid                               
           sequence). The conserved seven cysteine                        
           skeleton is defined by residues 38 to 139                      
           of Seq. ID Nos. 7 and 8. The cDNA                              
           sequences and the amino acids encoding the                     
           full length proteins are provided in Seq.                      
           ID Nos. 20 and 21 (hOP2) and Seq. ID Nos.                      
           22 and 23 (mOP2.) The mature proteins are                      
           defined essentially by residues 264-402                        
           of Seq. ID No. 21 (hOP2) and 261-399 of                        
           Seq. ID No. 23 (mOP2). The "pro"                               
           regions of the proteins, cleaved to yield                      
           the mature, morphogenically active                             
           proteins likely are defined essentially by                     
           residues 18-263 of Seq. ID No. 21 (hOP2)                       
           and residues 18-260 of Seq. ID No. 23                          
           (mOP2) (Another cleavage site also                             
           occurs 21 residues upstream in both OP-2                       
           proteins).                                                     
"CBMP2"    refers generically to the morphogenically                      
           active proteins expressed from a DNA                           
           sequence encoding the CBMP2 proteins,                          
           including allelic and species variants                         
           thereof, e.g., human CBMP2A, Seq ID                            
           No. 9) or human CBMP2B DNA, Seq. ID                            
           No. 10). The amino acid sequence for                           
           the full length proteins, referred to                          
           in the literature respectively as                              
           BMP2A and BMP2B, or as BMP2 and BMP4,                          
           appear in Wozney, et al. (1988)                                
           Science 242:1528-1534. The pro                                 
           domain for BMP2 (BMP2A) likely                                 
           includes residues 25-248 or 25-282                             
           of the published prepro-polypeptide sequence;                  
           the mature protein, residues 249-396 or                        
           283-396 of the published sequence. The pro                     
           domain for BMP4 (BMP2B) likely includes                        
           residues 25-256 or 25-292 of the                               
           published sequence; the mature protein,                        
           residues 257-408 of the published                              
           sequence or 293-408.                                           
"DPP(fx)"  refers to protein sequences encoded by the                     
           Drosophila DPP gene and defining the                           
           conserved seven cysteine skeleton thereof (Seq.                
           ID No. 11). The amino acid sequence for the                    
           full length protein appears in Padgett, et                     
           al (1987) Nature 325: 81-84. The pro                           
           domain likely extends from the signal                          
           peptide cleavage site to residue 456; the                      
           mature protein likely is defined by                            
           residues 457-588 of the published sequence.                    
"Vgl(fx)"  refers to protein sequences encoded by the                     
           Xenopus Vgl gene and defining the                              
           conserved seven cysteine skeleton thereof (Seq.                
           ID No. 12). The amino acid sequence for the                    
           full length protein appears in                                 
           Weeks (1987) Cell 51: 861-867. The                             
           prodomain likely extends from the signal                       
           peptide cleavage site to residue 246 of the                    
           published sequence; the mature protein likely                  
           is defined by residues 247-360 of the                          
           published sequence.                                            
"Vgr-1(fx)"                                                               
           refers to protein sequences encoded by the                     
           murine Vgr-1 gene and defining the                             
           conserved seven cysteine skeleton thereof                      
           (Seq. ID No. 13). The amino acid sequence                      
           for the full length protein appears in                         
           Lyons, et al, (1989) PNAS 86:                                  
           4554-4558. The prodomain likely extends                        
           from the signal peptide cleavage site                          
           to residue 299 of the published sequence;                      
           the mature protein likely is defined by                        
           residues 300-438 as published.                                 
"GDF-1(fx)"                                                               
           refers to protein sequences encoded by the                     
           human GDF-1 gene and defining the                              
           conserved seven cysteine skeleton thereof                      
           (Seq. ID No. 14). The cDNA and encoded                         
           amino sequence for the full length protein                     
           is provided in Seq. ID. Nos. 32 and 33                         
           respectively. The prodomain likely                             
           extends from the signal peptide                                
           cleavage site to residue 214 of Seq.                           
           ID No. 33; the mature protein likely                           
           is defined by residues 215-372                                 
           of Seq. ID No. 33.                                             
"60A"      refers generically to the morphogenically                      
           active proteins expressed from part or all                     
           of a DNA sequence encoding the Drosophila                      
           60A proteins. The cDNA and encoded full                        
           length amino acid sequence for the "60A(fx)"                   
           refers to the protein sequences defining                       
           the conserved seven cysteine skeleton                          
           thereof (residues 354 to 455 of Seq. ID                        
           No. 24). The prodomain likely extends                          
           from the signal peptide cleavage site                          
           to residue 324 of Seq. ID No. 24; the                          
           mature protein likely is defined by                            
           residues 325-455 of Seq. ID No. 24.                            
"BMP3(fx)" refers to protein sequences encoded by the                     
           human BMP3 gene and defining the conserved                     
           seven cysteine skeleton thereof (Seq. ID                       
           No. 26). The amino acid sequence for the                       
           full length protein appears in Wozney et al.                   
           (1988) Science 242: 1528-1534. The pro                         
           domain likely extends from the signal                          
           peptide cleavage site to residue 290 of                        
           the published sequence; the mature                             
           protein likely is defined by residues                          
           291-472 as published.                                          
"BMP5(fx)" refers to protein sequences encoded by the                     
           human BMP5 gene and defining the conserved                     
           seven cysteine skeleton thereof (Seq. ID                       
           No. 27). The amino acid sequence for the                       
           full length protein appears in Celeste,                        
           et al. (1991) PNAS 87: 9843-9847. The                          
           pro domain likely extends from the signal                      
           peptide cleavage site to residue 316 of                        
           the published sequence; the mature                             
           protein likely is defined by residues                          
           317-454 as published.                                          
"BMP6(fx)" refers to protein sequences encoded by the                     
           human BMP6 gene and defining the conserved                     
           seven cysteine skeleton thereof (Seq. ID                       
           No. 28). The amino acid sequence for the                       
           full length protein appears in Celeste,                        
           et al. (1990) PNAS 87: 9843-5847.                              
           The pro domain likely includes extends                         
           from the signal peptide cleavage site to                       
           residue 374 of the published sequence;                         
           the mature sequence likely includes                            
           residues 375-513 as published.                                 
______________________________________                                    
The OP-2 proteins (comprising, e.g., Seq. ID Nos. 7 and 8) have an additional cysteine residue in this region (e.g., see residue 41 of Seq. ID Nos. 7 and 8), in addition to the conserved cysteine skeleton in common with the other proteins in this family. The GDF-1 protein (comprising, e.g., Seq. ID No. 14), has a four amino acid insert within the conserved skeleton (residues 44-47 of Seq. ID No. 14) but this insert likely does not interfere with the relationship of the cysteines in the folded structure. In addition, the CBMP2 proteins (comprising, e.g., Seq. ID Nos. 9 and 10) are missing one amino acid residue within the cysteine skeleton.
The morphogens are inactive when reduced, but are ctive as oxidized homodimers and when oxidized in combination with other morphogens of this invention. Thus, as defined herein, a morphogen is a dimeric protein comprising a pair of polypeptide chains, wherein each polypeptide chain comprises at least the C-terminal six cysteine skeleton defined by residues 43-139 of Seq. ID No. 5, including functionally equivalent arrangements of these cysteines (e.g., amino acid insertions or deletions which alter the linear arrangement of the cysteines in the sequence but not their relationship in the folded structure), such that, when the polypeptide chains are folded, the dimeric protein species comprising the pair of polypeptide chains has the appropriate three-dimensional structure, including the appropriate intra- or inter-chain disulfide bonds such that the protein is capable of acting as a morphogen as defined herein. Specifically, the morphogens generally are capable of all of the following biological functions in a morphogenically permissive environment: stimulating proliferation of progenitor cells; stimulating the differentiation of progenitor cells; stimulating the proliferation of differentiated cells; and supporting the growth and maintenance of differentiated cells, including the "redifferentiation" of transformed cells. In addition, it is also anticipated that these morphogens are capable of inducing redifferentiation of committed cells under appropriate environmental conditions.
In one preferred aspect, the morphogens of this invention comprise one of two species of generic amino acid sequences: Generic Sequence 1 (Seq. ID No. 1) or Generic Sequence 2 (Seq. ID No. 2); where each Xaa indicates one of the 20 naturally-occurring L-isomer, α-amino acids or a derivative thereof. Generic Sequence 1 comprises the conserved six cysteine skeleton and Generic Sequence 2 comprises the conserved six cysteine (at residue 36 of Seq. ID No. 2) skeleton plus the additional cysteine identified in OP-2 (comprising, e.g., Seq. ID No. 6 or 7). In another preferred aspect, these sequences further comprise the following additional sequence at their N-terminus: ##STR1##
Preferred amino acid sequences within the foregoing generic sequences include: Generic Sequence 3 (Seq. ID No. 3), Generic Sequence 4 (Seq. ID No. 4), Generic Sequence 5 (Seq. ID No. 30) and Generic Sequence 6 (Seq. ID No. 31). These Generic Sequences accommodate the homologies shared among the various preferred members of this morphogen family identified in Table II, as well as the amino acid sequence variation among them. Specifically, Generic Sequences 3 and 4 are composite amino acid sequences of the following proteins presented in Table II: human OP-1 (hOP-1, comprising, e.g., Seq. ID Nos. 5 and 16-17), mouse OP-1 (mOP-1, comprising, e.g., Seq. ID Nos. 6 and 18-19), human and mouse OP-2 (comprising, e.g., Seq. ID Nos. 7, 8, and 20-22), CBMP2A (Seq. ID No. 9), CBMP2B (comprising, e.g., Seq. ID No. 10), DPP (from Drosophila comprising, e.g, Seq. ID No. 11), Vgl, (from Xenopus comprising, e.g., Seq. ID No. 12), Vgr-1 (from mouse comprising, e.g., Seq. ID No. 13), and GDF-1 (from mouse comprising, e.g., Seq. ID No. 14.) The generic sequences include both the amino acid identity shared by the sequences in Table II, as well as alternative residues for the variable positions within the sequence. Note that these generic sequences allow for an additional cysteine at position 41 or 46 in Generic Sequences 3 or 4 (Seq. ID Nos. 3 or 4), respectively, providing an appropriate cysteine skeleton where inter- or intramolecular disulfide bonds can form, and contain certain critical amino acids which influence the tertiary structure of the proteins. ##STR2## wherein each Xaa is independently selected from a group of one or more specified amino acids defined as follows: "Res." means "residue" and Xaa at res.4=(Ser, Asp or Glu); Xaa at res.6=(Arg, Gln, Ser or Lys); Xaa at res.7=(Asp or Glu); Xaa at res.8=(Leu or Val); Xaa at res.11=(Gln, Leu, Asp, His or Asn); Xaa at res.12=(Asp, Arg or Asn); Xaa at res.14=(Ile or Val); Xaa at res.15=(Ile or Val); Xaa at res.18=(Glu, Gln, Leu, Lys, Pro or Arg); Xaa at res.20=(Tyr or Phe); Xaa at res.21=(Ala, Ser, Asp, Met, His, Leu or Gln); Xaa at res.23=(Tyr, Asn or Phe); Xaa at res.26=(Glu, His, Tyr, Asp or Gln); Xaa at res.28=(Glu, Lys, Asp or Gln); Xaa at res.30=(Ala, Ser, Pro or Gln); Xaa at res.31=(Phe, Leu or Tyr); Xaa at res.33=(Leu or Val); Xaa at res.34=(Asn, Asp, Ala or Thr); Xaa at res.35=(Ser, Asp, Glu, Leu or Ala); Xaa at res.36=(Tyr, Cys, His, Ser or Ile); Xaa at res.37=(Met, Phe, Gly or Leu); Xaa at res.38=(Asn or Ser); Xaa at res.39=(Ala, Ser or Gly); Xaa at res.40=(Thr, Leu or Ser); Xaa at res.44=(Ile or Val); Xaa at res.45=(Val or Leu); Xaa at res.46=(Gln or Arg); Xaa at res.47=(Thr, Ala or Ser); Xaa at res.49=(Val or Met); Xaa at res.50=(His or Asn); Xaa at res.51=(Phe, Leu, Asn, Ser, Ala or Val); Xaa at res.52=(Ile, Met, Asn, Ala or Val); Xaa at res.53=(Asn, Lys, Ala or Glu); Xaa at res.54=(Pro or Ser); Xaa at res.55=(Glu, Asp, Asn, or Gly); Xaa at res.56=(Thr, Ala, Val, Lys, Asp, Tyr, Ser or Ala); Xaa at res.57=(Val, Ala or Ile); Xaa at res.58=(Pro or Asp); Xaa at res.59=(Lys or Leu); Xaa at res.60=(Pro or Ala); Xaa at res.63=(Ala or Val); Xaa at res.65=(Thr or Ala); Xaa at res.66=(Gln, Lys, Arg or Glu); Xaa at res.67=(Leu, Met or Val); Xaa at res.68=(Asn, Ser or Asp); Xaa at res.69=(Ala, Pro or Ser); Xaa at res.70=(Ile, Thr or Val); Xaa at res.71=(Ser or Ala); Xaa at res.72=(Val or Met); Xaa at res.74=(Tyr or Phe); Xaa at res.75=(Phe, Tyr or Leu); Xaa at res.76=(Asp or Asn); Xaa at res.77=(Asp, Glu, Asn or Ser); Xaa at res.78=(Ser, Gln, Asn or Tyr); Xaa at res.79=(Ser, Asn, Asp or Glu); Xaa at res.80=(Asn, Thr or Lys); Xaa at res.82=(Ile or Val); Xaa at res.84=(Lys or Arg); Xaa at res.85=(Lys, Asn, Gln or His); Xaa at res.86=(Tyr or His); Xaa at res.87=(Arg, Gln or Glu); Xaa at res.88=(Asn, Glu or Asp); Xaa at res.90=(Val, Thr or Ala); Xaa at res.92=(Arg, Lys, Val, Asp or Glu); Xaa at res.93=(Ala, Gly or Glu); and Xaa at res.97=(His or Arg); ##STR3## wherein each Xaa is independently selected from a group of one or more specified amino acids as defined by the following: "Res." means "residue" and Xaa at res.2=(Lys or Arg); Xaa at res.3=(Lys or Arg); Xaa at res.4=(His or Arg); Xaa at res.5=(Glu, Ser, His, Gly, Arg or Pro); Xaa at res.9=(Ser, Asp or Glu); Xaa at res.11=(Arg, Gln, Ser or Lys); Xaa at res.12=(Asp or Glu); Xaa at res.13=(Leu or Val); Xaa at res.16(Gln, Leu, Asp, His or Asn); Xaa at res.17=(Asp, Arg, or Asn); Xaa at res.19=(Ile or Val); Xaa at res.20=(Ile or Val); Xaa at res.23=(Glu, Gln, Leu, Lys, Pro or Arg); Xaa at res.25=(Tyr or Phe); Xaa at res.26=(Ala, Ser, Asp, Met, His, Leu, or Gln); Xaa at res.28=(Tyr, Asn or Phe); Xaa at res.31=(Glu, His, Tyr, Asp or Gln); Xaa at res.33=Glu, Lys, Asp or Gln); Xaa at res.35=(Ala, Ser or Pro); Xaa at res.36=(Phe, Leu or Tyr); Xaa at res.38=(Leu or Val); Xaa at res.39=(Asn, Asp, Ala or Thr); Xaa at res.40=(Ser, Asp, Glu, Leu or Ala); Xaa at res.41=(Tyr, Cys, His, Ser or Ile); Xaa at res.42=(Met, Phe, Gly or Leu); Xaa at res.44=(Ala, Ser or Gly); Xaa at res.45=(Thr, Leu or Ser); Xaa at res.49=(Ile or Val); Xaa at res.50=(Val or Leu); Xaa at res.51=(Gln or Arg); Xaa at res.52=(Thr, Ala or Ser); Xaa at res.54=(Val or Met); Xaa at res.55=(His or Asn); Xaa at res.56=(Phe, Leu, Asn, Ser, Ala or Val); Xaa at res.57=(Ile, Met, Asn, Ala or Val); Xaa at res.58=(Asn, Lys, Ala or Glu); Xaa at res.59=(Pro or Ser); Xaa at res.60=(Glu, Asp, or Gly); Xaa at res.61=(Thr, Ala, Val, Lys, Asp, Tyr, Ser or Ala); Xaa at res.62=(Val, Ala or Ile); Xaa at res.63=(Pro or Asp); Xaa at res.64=(Lys or Leu); Xaa at res.65=(Pro or Ala); Xaa at res.68=(Ala or Val); Xaa at res.70=(Thr or Ala); Xaa at res.71=(Gln, Lys, Arg or Glu); Xaa at res.72=(Leu, Met or Val); Xaa at res.73=(Asn, Ser or Asp); Xaa at res.74=(Ala, Pro or Ser); Xaa at res.75=(Ile, Thr or Val); Xaa at res.76=(Ser or Ala); Xaa at res.77=(Val or Met); Xaa at res.79=(Tyr or Phe); Xaa at res.80=(Phe, Tyr or Leu); Xaa at res.81=(Asp or Asn); Xaa at res.82=(Asp, Glu, Asn or Ser); Xaa at res.83=(Ser, Gln, Asn or Tyr); Xaa at res.84=(Ser, Asn, Asp or Glu); Xaa at res.85=(Asn, Thr or Lys); Xaa at res.87=(Ile or Val); Xaa at res.89=(Lys or Arg); Xaa at res.90=(Lys, Asn, Gln or His); Xaa at res.91=(Tyr or His); Xaa at res.92=(Arg, Gln or Glu); Xaa at res.93=(Asn, Glu or Asp); Xaa at res.95=(Val, Thr or Ala); Xaa at res.97=(Arg, Lys, Val, Asp or Glu); Xaa at res.98=(Ala, Gly or Glu); and Xaa at res.102=(His or Arg).
Similarly, Generic Sequence 5 (Seq. ID No. 30) and Generic Sequence 6 (Seq. ID No. 31) accommodate the homologies shared among all the morphogen protein family members identified in Table II. Specifically, Generic Sequences 5 and 6 are composite amino acid sequences of human OP-1 (hOP-1, comprising, e.g., Seq. ID Nos. 5 and 16-17), mouse OP-1 (mOP-1comprising, e.g., Seq. ID Nos. 6 and 18-19), human and mouse OP-2 (comprising, e.g., Seq. ID Nos. 7, 8, and 20-22), CBMP2A (comprising, e.g., Seq. ID No. 9), CBMP2B (comprising, e.g., Seq. ID No. 10), DPP (from Drosophila comprising, e.g., Seq. ID No. 11), Vgl, (from Xenopus comprising, e.g., Seq. ID No. 12), Vgr-1 (from mouse comprising, e.g., Seq. ID No. 13), and GDF-1 (from mouse comprising, e.g., Seq. ID No. 14), human BMP3 (comprising, e.g., Seq. ID No. 26), human BMP5 (comprising, e.g., Seq. ID No. 27), human BMP6 (comprising, e.g., Seq. ID No. 28) and 60(A) (from Drosophila comprising, e.g., Seq.
ID Nos. 24-25). The generic sequences include both the 25 amino acid identity shared by these sequences in the C-terminal domain, defined by the six and seven cysteine skeletons ( Generic Sequences 5 and 6, respectively), as well as alternative residues for the variable positions within the sequence. As for Generic Sequences 3 and 4 (Seq ID. Nos. 2 and 4), Generic Sequences 5 and 6 (Seq. ID Nos. 30 and 31) allow for an additional cysteine at position 41 (Generic Sequence 5) or position 46 (Generic Sequence 6), providing an appropriate cysteine skeleton where inter- or intramolecular disulfide bonds can form, and containing certain critical amino acids which influence the tertiary structure of the proteins. ##STR4## wherein each Xaa is independently selected from a group of one or more specified amino acids defined as follows: "Res." means "residue" and Xaa at res.2=(Tyr or Lys); Xaa at res.3=Val or Ile); Xaa at res.4=(Ser, Asp or Glu); Xaa at res.6=(Arg, Gln, Ser, Lys or Ala); Xaa at res.7=(Asp, Glu or Lys); Xaa at res.8=(Leu, Val or Ile); Xaa at res.11=(Gln, Leu, Asp, His, Asn or Ser); Xaa at res.12=(Asp, Arg, Asn or Glu); Xaa at res.14=(Ile or Val); Xaa at res.15=(Ile or Val); Xaa at res.16(Ala or Ser); Xaa at res.18=(Glu, Gln, Leu, Lys, Pro or Arg); Xaa at res.19=(Gly or Ser); Xaa at res.20=(Tyr or Phe); Xaa at res.21=(Ala, Ser, Asp, Met, His, Gln, Leu or Gly); Xaa at res.23=(Tyr, Asn or Phe); Xaa at res.26=(Glu, His, Tyr, Asp, Gln or Ser); Xaa at res.28=(Glu, Lys, Asp, Gln or Ala); Xaa at res.30=(Ala, Ser, Pro, Gln or Asn); Xaa at res.31=(Phe, Leu or Tyr); Xaa at res.33=(Leu, Val or Met); Xaa at res.34=(Asn, Asp, Ala, Thr or Pro); Xaa at res.35=(Ser, Asp, Glu, Leu, Ala or Lys); Xaa at res.36=(Tyr, Cys, His, Ser or Ile); Xaa at res.37=(Met, Phe, Gly or Leu); Xaa at res.38=(Asn, Ser or Lys); Xaa at res.39=(Ala, Ser, Gly or Pro); Xaa at res.40=(Thr, Leu or Ser); Xaa at res.44=(Ile, Val or Thr); Xaa at res.45=(Val, Leu or Ile); Xaa at res.46=(Gln or Arg); Xaa at res.47=(Thr, Ala or Ser); Xaa at res.48=(Leu or Ile); Xaa at res.49=(Val or Met); Xaa at res.50=(His, Asn or Arg); Xaa at res.51=(Phe, Leu, Asn, Ser, Ala or Val); Xaa at res.52=(Ile, Met, Asn, Ala, Val or Leu); Xaa at res.53=(Asn, Lys, Ala, Glu, Gly or Phe); Xaa at res.54=(Pro, Ser or Val); Xaa at res.55=(Glu, Asp, Asn, Gly, Val or Lys); Xaa at res.56=(Thr, Ala, Val, Lys, Asp, Tyr, Ser, Ala, Pro or His); Xaa at res.57=(Val, Ala or Ile); Xaa at res.58=(Pro or Asp); Xaa at res.59=(Lys, Leu or Glu); Xaa at res.60=(Pro or Ala); Xaa at res.63=(Ala or Val); Xaa at res.65=(Thr, Ala or Glu); Xaa at res.66=(Gln, Lys, Arg or Glu); Xaa at res.67=(Leu, Met or Val); Xaa at res.68=(Asn, Ser, Asp or Gly); Xaa at res.69=(Ala, Pro or Ser); Xaa at res.70=(Ile, Thr, Val or Leu); Xaa at res.71=(Ser, Ala or Pro); Xaa at res.72=(Val, Met or Ile); Xaa at res.74=(Tyr or Phe); Xaa at res.75=(Phe, Tyr, Leu or His); Xaa at res.76=(Asp, Asn or Leu); Xaa at res.77=(Asp, Glu, Asn or Ser); Xaa at res.78=(Ser, Gln, Asn, Tyr or Asp); Xaa at res.79=(Ser, Asn, Asp, Glu or Lys); Xaa at res.80=(Asn, Thr or Lys); Xaa at res.82=(Ile, Val or Asn); Xaa at res.84=(Lys or Arg); Xaa at res.85=(Lys, Asn, Gln, His or Val); Xaa at res.86=(Tyr or His); Xaa at res.87=(Arg, Gln, Glu or Pro); Xaa at res.88=(Asn, Glu or Asp); Xaa at res.90=(Val, Thr, Ala or Ile); Xaa at res.92=(Arg, Lys, Val, Asp or Glu); Xaa at res.93=(Ala, Gly, Glu or Ser); Xaa at res.95=(Gly or Ala) and Xaa at res.97=(His or Arg). ##STR5## wherein each Xaa is independently selected from a group of one or more specified amino acids as defined by the following: "Res." means "residue" and Xaa at res.2=(Lys, Arg, Ala or Gln); Xaa at res.3=(Lys, Arg or Met); Xaa at res.4=(His, Arg or Gln); Xaa at res.5=(Glu, Ser, His, Gly, Arg, Pro, Thr, or Tyr); Xaa at res.7=(Tyr or Lys); Xaa at res.8=(Val or Ile); Xaa at res.9=(Ser, Asp or Glu); Xaa at res.11=(Arg, Gln, Ser, Lys or Ala); Xaa at res.12=(Asp, Glu, or Lys); Xaa at res.13=(Leu, Val or Ile); Xaa at res.16=(Gln, Leu, Asp, His, Asn or Ser); Xaa at res.17=(Asp, Arg, Asn or Glu); Xaa at res.19=(Ile or Val); Xaa at res.20=(Ile or Val); Xaa at res.21=(Ala or Ser); Xaa at res.23=(Glu, Gln, Leu, Lys, Pro or Arg); Xaa at res.24=(Gly or Ser); Xaa at res.25=(Tyr or Phe); Xaa at res.26=(Ala, Ser, Asp, Met, His, Gln, Leu, or Gly); Xaa at res.28=(Tyr, Asn or Phe); Xaa at res.31=(Glu, His, Tyr, Asp, Gln or Ser); Xaa at res.33=Glu, Lys, Asp, Gln or Ala); Xaa at res.35=(Ala, Ser, Pro, Gln or Asn); Xaa at res.36=(Phe, Leu or Tyr); Xaa at res.38=(Leu, Val or Met); Xaa at res.39=(Asn, Asp, Ala, Thr or Pro); Xaa at res.40=(Ser, Asp, Glu, Leu, Ala or Lys); Xaa at res.41=(Tyr, Cys, His, Ser or Ile); Xaa at res.42=(Met, Phe, Gly or Leu); Xaa at res.43=(Asn, Ser or Lys); Xaa at res.44=(Ala, Ser, Gly or Pro); Xaa at res.45=(Thr, Leu or Ser); Xaa at res.49=(Ile, Val or Thr); Xaa at res.50=(Val, Leu or Ile); Xaa at res.51=(Gln or Arg); Xaa at res.52=(Thr, Ala or Ser); Xaa at res.53=(Leu or Ile); Xaa at res.54=(Val or Met); Xaa at res.55=(His, Asn or Arg); Xaa at res.56=(Phe, Leu, Asn, Ser, Ala or Val); Xaa at res.57=(Ile, Met, Asn, Ala, Val or Leu); Xaa at res.58=(Asn, Lys, Ala, Glu, Gly or Phe); Xaa at res.59=(Pro, Ser or Val); Xaa at res.60=(Glu, Asp, Gly, Val or Lys); Xaa at res.61=(Thr, Ala, Val, Lys, Asp, Tyr, Ser, Ala, Pro or His); Xaa at res.62=(Val, Ala or Ile); Xaa at res.63=(Pro or Asp); Xaa at res.64=(Lys, Leu or Glu); Xaa at res.65=(Pro or Ala); Xaa at res.68=(Ala or Val); Xaa at res.70=(Thr, Ala or Glu); Xaa at res.71=(Gln, Lys, Arg or Glu); Xaa at res.72=(Leu, Met or Val); Xaa at res.73=(Asn, Ser, Asp or Gly); Xaa at res.74=(Ala, Pro or Ser); Xaa at res.75=(Ile, Thr, Val or Leu); Xaa at res.76=(Ser, Ala or Pro); Xaa at res.77=(Val, Met or Ile); Xaa at res.79=(Tyr or Phe); Xaa at res.80=(Phe, Tyr, Leu or His); Xaa at res.81=(Asp, Asn or Leu); Xaa at res.82=(Asp, Glu, Asn or Ser); Xaa at res.83=(Ser, Gln, Asn, Tyr or Asp); Xaa at res.84=(Ser, Asn, Asp, Glu or Lys); Xaa at res.85=(Asn, Thr or Lys); Xaa at res.87=(Ile, Val or Asn); Xaa at res.89=(Lys or Arg); Xaa at res.90=(Lys, Asn, Gln, His or Val); Xaa at res.91=(Tyr or His); Xaa at res.92=(Arg, Gln, Glu or Pro); Xaa at res.93=(Asn, Glu or Asp); Xaa at res.95=(Val, Thr, Ala or Ile); Xaa at res.97=(Arg, Lys, Val, Asp or Glu); Xaa at res.98=(Ala, Gly, Glu or Ser); Xaa at res.100=(Gly or Ala); and Xaa at res.102=(His or Arg).
Particularly useful sequences for use as morphogens in this invention include the C-terminal domains, e.g., the C-terminal 96-102 amino acid residues of vgl (Seq. ID No. 12), Vgr-1 (Seq. ID No. 13), DPP (Seq. ID No. 11), OP-1 (Seq. ID No. 5 or 6), OP-2 (Seq. ID No. 7 or 8), CBMP-2A (Seq. ID No. 9), CBMP-2B (Seq. ID No. 10, GDF-1 (Seq. ID No. 14) Table II, below, as well as proteins comprising the C-terminal domains of 60A (residues 354-455 of Seq. ID No. 25), BMP3 (Seq. ID No. 26), BMP5 (Seq. ID No. 27) and BMP6 (Seq. ID No. 28) see also Table II,, all of which include at least the conserved six or seven cysteine skeleton. In addition, biosynthetic constructs designed from the generic sequences, such as COP-1, 3-5, 7, 16, disclosed in U.S. Pat. No. 5,011,691, also are useful. Other sequences include the inhibins/activin proteins (see, for example, U.S. Pat. Nos. 4,968,590 and 5,011,691). Accordingly, other useful sequences are those sharing at least 70% amino acid sequence homology or "similarity", and preferably 80% homology or similarity with any of the sequences above. These are anticipated to include allelic and species variants and mutants, and biosynthetic muteins, as well as novel members of this morphogenic family of proteins. Particularly envisioned in the family of related proteins are those proteins exhibiting morphogenic activity and wherein the amino acid changes from the preferred sequences include conservative changes, e.g., those as defined by Dayoff et al., Atlas of Protein Sequence and Structure; vol. 5, Suppl. 3, pp. 345-362, (M. O. Dayoff, ed., Nat'l BioMed. Research Fdn., Washington, D.C. 1979). As used herein, potentially useful sequences are aligned with a known morphogen sequence using the method of Needleman et al. ((1970) J.Mol.Biol. 48:443-453) and identities calculated by the Align program (DNAstar, Inc.). "Homology" or "similarity" as used herein includes allowed conservative changes as defined by Dayoff et al.
The currently most preferred protein sequences useful as morphogens in this invention include those having greater than 60% identity, preferably greater than 65% identity, with the amino acid sequence defining the conserved six cysteine skeleton of hOP1 (e.g., residues 43-139 of Seq. ID No. 5). These most preferred sequences include both allelic and species variants of the OP-1 and OP-2 proteins (comprising, respectively, e.g., Seq. ID Nos. 5-8), including the Drosophila 60A protein (comprising e.g., Seq. ID NO. 25). Accordingly, in another preferred aspect of the invention, useful morphogens include active proteins comprising species of polypeptide chains having the generic amino acid sequence herein referred to as "OPX"(Seq. ID No. 29), which accommodates the homologies between the various identified species of OP1 and OP2 (comprising the sequences shown in Seq. ID Nos. 5-8(Seq. ID No. 29).
The morphogens useful in the methods, composition and devices of this invention include proteins comprising any of the polypeptide chains described above, whether isolated from naturally-occurring sources, or produced by recombinant DNA or other synthetic techniques, and includes allelic and species variants of these proteins, naturally-occurring or biosynthetic mutants thereof, as well as various truncated and fusion constructs. Deletion or addition mutants also are envisioned to be active, including those which may alter the conserved C-terminal cysteine skeleton, provided that the alteration does not functionally disrupt the relationship of these cysteines in the folded structure. Accordingly, such active forms are considered the equivalent of the specifically described constructs disclosed herein. The proteins may include forms having varying glycosylation patterns, varying N-termini, a family of related proteins having regions of amino acid sequence homology, and active truncated, chimeric and/or mutated forms of native or biosynthetic proteins, produced by expression of recombinant DNA in host cells.
The morphogenic proteins can be expressed from intact, chimeric and/or truncated cDNA or from synthetic DNAs in procaryotic or eucaryotic host cells, and purified, cleaved, refolded, and dimerized to form morphogenically active compositions. Currently preferred host cells include E. coli or mammalian cells, such as CHO, COS or BSC cells. A detailed description of the morphogens useful in the methods, compositions and devices of this invention is disclosed in commonly owned U.S. patent application Ser. Nos. 752,764, filed Aug. 30, 1991 (now abandoned), and 667,274, filed Mar. 11, 1991 (now abandoned), the disclosure of which are incorporated herein by reference.
Thus, in view of this disclosure, skilled genetic engineers can isolate genes from cDNA or genomic libraries of various different species which encode appropriate amino acid sequences, or construct DNAs from oligonucleotides, and then can express them in various types of host cells, including both procaryotes and eucaryotes, to produce large quantities of active proteins capable of maintaining liver function in a mammal, including correcting liver function deficiencies and stimulating hepatic tissue regeneration and repair in a variety of mammals, including humans.
The foregoing and other objects, features and advantages of the present invention will be made more apparent from the following detailed description of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
The foregoing and other objects and features of this invention, as well as the invention itself, may be more fully understood from the following description, when read together with the accompanying drawings, in which:
FIG. 1 is a photograph of a Northern blot identifying OP-1-specific mRNA expression in developing liver tissue in embryonic and postnatal mouse;
FIG. 2 is a photograph showing the effect of phosphate buffered saline (PBS, animal 1) or morphogen (OP-1, animal 2) on partially hepatectomized rats (arrow indicates the treated lobe in both animals);
FIG. 3 is a photograph of a Northern blot of mRNA isolated from sham-operated ( lanes 3, 5, 7, 9, 11, 13 and 15) and partially hepatectomized rats ( lanes 2, 4, 6, 8, 10, 12, 14) at 6 hr intervals between 12-96 hours post surgery, probed with an mOP-1-specific probe;
FIG. 4 is a photograph of a Northern blot of mRNA isolated from galactosamine-treated rats and probed with mOP-1-specific probe on days 0-7, 10 (lanes 1-9, respectively);
FIGS. 5 (A and B) are schematic representations of morphogen inhibition of early mononuclear phagocytic cell multinuclearization in vivo; and
FIGS. 6 (A-D) graphs the effects of a morphogen (e.g., OP-1, FIGS. 6A and 6C) and TGF-B (FIG. 6B and 6D) on collagen (6A and 6B) and hyaluronic acid (6C and 6D) production in primary fibroblast cultures.
DETAILED DESCRIPTION OF THE INVENTION
It now has been discovered that the proteins described herein are effective agents for maintaining liver function in a mammal. As described herein, these proteins ("morphogens") are capable of inducing hepatic tissue regeneration and repair under conditions where true tissue morphogenesis typically does not occur, including stimulating the proliferation and differentiation of hepatocytic progenitor cells. The proteins also are capable of providing a cytoprotective effect to alleviate the tissue destructive effects associated with immunologically-related hepatic tissue damage. Accordingly, the proteins may be used as part of a protocol for regenerating damaged or lost hepatic tissue, correcting a liver function deficiency, and enhancing the viability of a tissue or organ to be transplanted in a mammal. The morphogens also may be used in a gene therapy protocol to correct a protein deficiency in a mammal.
Provided below are detailed descriptions of suitable morphogens useful in the methods, compositions and devices of this invention, as well as methods for their administration and application, and numerous, nonlimiting examples which 1) illustrate the suitability of the morphogens and morphogen-stimulating agents described herein as therapeutic agents for maintaining liver function in a mammal; and 2) provide assays with which to test candidate morphogens and morphogen-stimulating agents for their efficacy. Specifically, the examples demonstrate the expression distribution of endogenous morphogen (Example 1), the expression of endogenous morphogen during liver formation in a developing embryo (Example 2), the ability of morphogens to induce proliferation of primary hepatocytes (Example 3), morphogen-induced liver tissue morphogenesis following partial hepatectomy (Example 4); endogenous morphogen expression during hepatic tissue repair following toxin-induced tissue damage (Examples 5); the inhibitory effect of morphogens on the body's cellular and humoral immune response (Example 6); effect of morphogen on fibrogenesis (Example 7); morphogen utility in liver diagnostic procedures (Example 8), and a screening assay for testing candidate morphogen-stimulating agents (Example 9).
I. Useful Morphogens
As defined herein a protein is morphogenic if it is capable of inducing the developmental cascade of cellular and molecular events that culminate in the formation of new, organ-specific tissue and comprises at least the conserved C-terminal six cysteine skeleton or its functional equivalent (see supra). Specifically, the morphogens generally are capable of all of the following biological functions in a morphogenically permissive environment: stimulating proliferation of progenitor cells; stimulating the differentiation of progenitor cells; stimulating the proliferation of differentiated cells; and supporting the growth and maintenance of differentiated cells, including the "redifferentiation" of transformed cells. Details of how the morphogens useful in the method of this invention first were identified, as well as a description on how to make, use and test them for morphogenic activity are disclosed in U.S. Ser. No. 667,274, filed Mar. 11, 1991 and U.S. Ser. No. 752,764, filed Aug. 30, 1991, both now abandoned the disclosures of which are hereby incorporated by reference. A candidate morphogen or morphogen composition can be evaluated for in vivo morphogenic utility generally according to the procedures set forth in U.S. Ser. No. 07/752,764 commonly owned, abandoned. The proteins and compositions may be injected or surgically implanted in a mammal, following any of a number of procedures well known in the art. For example, surgical implant bioassays may be performed essentially following the procedure of Sampath et al. (1983) PNAS 80:6591-6595.
Histological sectioning and staining is preferred to determine the extent of morphogenesis in vivo, particularly in tissue repair procedures. Excised implants are fixed in Bouins Solution, embedded in paraffin, and cut into 6-8 μm sections. Staining with toluidine blue or hemotoxylin/eosin demonstrates clearly the ultimate development of the new tissue. Twelve day implants are usually sufficient to determine whether the implants contain newly induced tissue.
Successful implants exhibit a controlled progression through the stages of induced tissue development allowing one to identify and follow the tissue-specific events that occur. For example, in endochondral bone formation the stages include:
(1) leukocytes on day one;
(2) mesenchymal cell migration and proliferation on days two and three;
(3) chondrocyte appearance on days five and six;
(4) cartilage matrix formation on day seven;
(5) cartilage calcification on day eight;
(6) vascular invasion, appearance of osteoblasts, and formation of new bone on days nine and ten;
(7) appearance of osteoblastic and bone remodeling and dissolution of the implanted matrix on days twelve to eighteen; and
(8) hematopoietic bone marrow differentiation in the ossicle on day twenty-one.
In addition to histological evaluation, biological markers may be used as a marker for tissue morphogenesis. Useful markers include tissue-specific enzymes whose activity may be assayed (e.g., spectrophotometrically) after homogenization of the implant. These assays may be useful for quantitation and for obtaining an estimate of tissue formation quickly after the implants are removed from the animal. For example, alkaline phosphatase activity may be used as a marker for osteogenesis.
Incorporation of systemically provided morphogens may be followed using tagged morphogens (e.g., radioactively labelled) and determining their localization in new tissue, and/or by monitoring their disappearance from the circulatory system using a standard pulse-chase labeling protocol. The morphogen also may be provided with a tissue-specific molecular tag, whose uptake may be monitored and correlated with the concentration of morphogen provided.
The morphogen to be assayed according to the above-described exemplary procedures can be purified from naturally-sourced material, or can be recombinantly produced from procaryotic or eucaryotic host cells, into which genetic material encoding a morphogen, e.g., genetic material bearing one of the nucleic acid sequences disclosed herein, has been introduced. Alternatively, the above-described exemplary procedures can be used to determine whether a novel protein suspected of being a morphogen indeed has morphogenic activity.
Particularly useful proteins include those which comprise the naturally derived sequences disclosed in Table II. Other useful sequences include biosynthetic constructs such as those disclosed in U.S. Pat. No. 5,011,691, the disclosure of which is incorporated herein by reference (e.g., COP-1, COP-3, COP-4, COP-5, COP-7, and COP-16).
Accordingly, the morphogens useful in the methods and compositions of this invention also may be described by morphogenically active proteins having amino acid sequences sharing 70% or, preferably, 80% homology (similarity) with any of the sequences described above, where "homology" is as defined herein above.
The morphogens useful in the method of this invention also can be described by any of the 6 generic sequences described herein ( Generic Sequences 1, 2, 3, 4, 5 and 6; Seq. ID Nos. 1, 2, 3, 4, 30 and 31). Generic sequences 1 and 2 also may include, at their N-terminus, the sequence ##STR6##
Table II, set forth below, compares the amino acid sequences of the active regions of native proteins that have been identified as morphogens, including human OP-1 (hOP-1, Seq. ID Nos. 5 and 16-17), mouse OP-1 (mOP-1, Seq. ID Nos. 6 and 18-19), human and mouse OP-2 (Seq. ID Nos. 7, 8, and 20-b 23), CBMP2A (Seq. ID No. 9), CBMP2B (Seq. ID No. 10), BMP3 (Seq. ID No. 26), DPP (from Drosophila, Seq. ID No. 11), Vgl, (from Xenopus, Seq. ID No. 12), Vgr-1 (from mouse, Seq. ID No. 13), GDF-1 (from mouse, Seq. ID Nos. 14, 32 and 33), 60A protein (from Drosophila, Seq. ID Nos. 24 and 25), BMP5 (Seq. ID No. 27) and BMP6 (Seq. ID No. 28). The sequences are aligned essentially following the method of Needleman et al. (1970) J. Mol. Biol., 48:443-453, calculated using the Align Program (DNAstar, Inc.) In the table, three dots indicates that the amino acid in that position is the same as the amino acid in hOP-1. Three dashes indicates that no amino acid is present in that position, and are included for purposes of illustrating homologies. For example, amino acid residue 60 of CBMP-2A and CBMP-2B is "missing". Of course, both these amino acid sequences in this region comprise Asn-Ser (residues 58, 59), with CBMP-2A then comprising Lys and Ile, whereas CBMP-2B comprises Ser and Ile.
                                  TABLE II                                
__________________________________________________________________________
      Seq ID No:                                                          
__________________________________________________________________________
hoP-1  5     Cys Lys                                                      
                    Lys                                                   
                       His                                                
                          Glu                                             
                             Leu                                          
                                Tyr                                       
                                   Val Ser                                
                                          Phe                             
                                             Arg                          
                                                Asp                       
                                                   Leu                    
                                                      Gly                 
                                                         Trp              
                                                            Gln           
mOP-1  6     ... ...                                                      
                    ...                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                ...                                       
                                   ... ...                                
                                          ...                             
                                             ...                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            ...           
hOP-2  7     ... Arg                                                      
                    Arg                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                ...                                       
                                   ... ...                                
                                          ...                             
                                             Gln                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            Leu           
mOP-2  8     ... Arg                                                      
                    Arg                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                ...                                       
                                   ... Ser                                
                                          ...                             
                                             ...                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            Leu           
DPP   11     ... Arg                                                      
                    Arg                                                   
                       ...                                                
                          Ser                                             
                             ...                                          
                                ...                                       
                                   ... Asp                                
                                          ...                             
                                             Ser                          
                                                ...                       
                                                   Val                    
                                                      ...                 
                                                         ...              
                                                            Asp           
Vgl   12     ... ...                                                      
                    Lys                                                   
                       Arg                                                
                          His                                             
                             ...                                          
                                ...                                       
                                   ... Glu                                
                                          ...                             
                                             Lys                          
                                                ...                       
                                                   Val                    
                                                      ...                 
                                                         ...              
                                                            ...           
Vgr-1 13     ... ...                                                      
                    ...                                                   
                       ...                                                
                          Gly                                             
                             ...                                          
                                ...                                       
                                   ... ...                                
                                          ...                             
                                             Gln                          
                                                ...                       
                                                   Val                    
                                                      ...                 
                                                         ...              
                                                            ...           
CBMP-2A                                                                   
       9     ... ...                                                      
                    Arg                                                   
                       ...                                                
                          Pro                                             
                             ...                                          
                                ...                                       
                                   ... Asp                                
                                          ...                             
                                             Ser                          
                                                ...                       
                                                   Val                    
                                                      ...                 
                                                         ...              
                                                            Asn           
CBMP-2B                                                                   
      10     ... Arg                                                      
                    Arg                                                   
                       ...                                                
                          Ser                                             
                             ...                                          
                                ...                                       
                                   ... Asp                                
                                          ...                             
                                             Ser                          
                                                ...                       
                                                   Val                    
                                                      ...                 
                                                         ...              
                                                            Asn           
BMP3  26     ... Ala                                                      
                    Arg                                                   
                       Arg                                                
                          Tyr                                             
                             ...                                          
                                Lys                                       
                                   ... Asp                                
                                          ...                             
                                             Ala                          
                                                ...                       
                                                   Ile                    
                                                      ...                 
                                                         ...              
                                                            Ser           
GDF-1 14     ... Arg                                                      
                    Ala                                                   
                       Arg                                                
                          Arg                                             
                             ...                                          
                                ...                                       
                                   ... ...                                
                                          ...                             
                                             ...                          
                                                Glu                       
                                                   Val                    
                                                      ...                 
                                                         ...              
                                                            His           
50A   25     ... Gln                                                      
                    Met                                                   
                       Glu                                                
                          Thr                                             
                             ...                                          
                                ...                                       
                                   ... Asp                                
                                          ...                             
                                             Lys                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            His           
BMP5  27     ... ...                                                      
                    ...                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                ...                                       
                                   ... ...                                
                                          ...                             
                                             ...                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            ...           
BMP6  28     ... Arg                                                      
                    ...                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                ...                                       
                                   ... ...                                
                                          ...                             
                                             Gln                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            ...           
             1            5               10             15               
__________________________________________________________________________
      Seq ID No:                                                          
__________________________________________________________________________
hOP-1  5     Asp Trp                                                      
                    Ile                                                   
                       Ile                                                
                          Ala                                             
                             Pro                                          
                                Glu                                       
                                   Gly Tyr                                
                                          Ala                             
                                             Ala                          
                                                Tyr                       
                                                   Tyr                    
                                                      Cys                 
                                                         Glu              
                                                            Gly           
mOP-1  6     ... ...                                                      
                    ...                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                ...                                       
                                   ... ...                                
                                          ...                             
                                             ...                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            ...           
hOP-2  7     ... ...                                                      
                    Val                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                Gln                                       
                                   ... ...                                
                                          Ser                             
                                             ...                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            ...           
mOP-2  8     ... ...                                                      
                    Val                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                Gln                                       
                                   ... ...                                
                                          Ser                             
                                             ...                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            ...           
DPP   11     ... ...                                                      
                    ...                                                   
                       Val                                                
                          ...                                             
                             ...                                          
                                Leu                                       
                                   ... ...                                
                                          Asp                             
                                             ...                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         His              
                                                            ...           
Vgl   12     Asn ...                                                      
                    Val                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                Gln                                       
                                   ... ...                                
                                          Met                             
                                             ...                          
                                                Asn                       
                                                   ...                    
                                                      ...                 
                                                         Tyr              
                                                            ...           
Vgr-1 13     ... ...                                                      
                    ...                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                Lys                                       
                                   ... ...                                
                                          ...                             
                                             ...                          
                                                Asn                       
                                                   ...                    
                                                      ...                 
                                                         Asp              
                                                            ...           
CBMP-2A                                                                   
       9     ... ...                                                      
                    ...                                                   
                       Val                                                
                          ...                                             
                             ...                                          
                                Pro                                       
                                   ... ...                                
                                          His                             
                                             ...                          
                                                Phe                       
                                                   ...                    
                                                      ...                 
                                                         His              
                                                            ...           
CBMP-2B                                                                   
      10     ... ...                                                      
                    ...                                                   
                       Val                                                
                          ...                                             
                             ...                                          
                                Pro                                       
                                   ... ...                                
                                          Gln                             
                                             ...                          
                                                Phe                       
                                                   ...                    
                                                      ...                 
                                                         His              
                                                            ...           
BMP3  26     Glu ...                                                      
                    ...                                                   
                       ...                                                
                          Ser                                             
                             ...                                          
                                Lys                                       
                                   Ser Phe                                
                                          Asp                             
                                             ...                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         Ser              
                                                            ...           
GDF-1 14     Arg ...                                                      
                    Val                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                Arg                                       
                                   ... Phe                                
                                          Leu                             
                                             ...                          
                                                Asn                       
                                                   ...                    
                                                      ...                 
                                                         Gln              
                                                            ...           
60A   25     ... ...                                                      
                    ...                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                ...                                       
                                   ... ...                                
                                          Gly                             
                                             ...                          
                                                Phe                       
                                                   ...                    
                                                      ...                 
                                                         Ser              
                                                            ...           
BMP5  27     ... ...                                                      
                    ...                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                ...                                       
                                   ... ...                                
                                          ...                             
                                             ...                          
                                                Phe                       
                                                   ...                    
                                                      ...                 
                                                         Asp              
                                                            ...           
BMP6  28     ... ...                                                      
                    ...                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                Lys                                       
                                   ... ...                                
                                          ...                             
                                             ...                          
                                                Asn                       
                                                   ...                    
                                                      ...                 
                                                         Asp              
                                                            ...           
                       20              25             30                  
__________________________________________________________________________
      Seq ID No:                                                          
__________________________________________________________________________
hOP-1  5     Glu Cys                                                      
                    Ala                                                   
                       Phe                                                
                          Pro                                             
                             Leu                                          
                                Asn                                       
                                   Ser Tyr                                
                                          Met                             
                                             Asn                          
                                                Ala                       
                                                   Thr                    
                                                      Asn                 
                                                         His              
                                                            Ala           
mOP-1  6     ... ...                                                      
                    ...                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                ...                                       
                                   ... ...                                
                                          ...                             
                                             ...                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            ...           
hOP-2  7     ... ...                                                      
                    Ser                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                Asp                                       
                                   ... Cys                                
                                          ...                             
                                             ...                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            ...           
mOP-2  8     ... ...                                                      
                    ...                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                Asp                                       
                                   ... Cys                                
                                          ...                             
                                             ...                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            ...           
DPP   11     Lys ...                                                      
                    Pro                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                Ala                                       
                                   Asp His                                
                                          Phe                             
                                             ...                          
                                                Ser                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            ...           
Vgl   12     ... ...                                                      
                    Pro                                                   
                       Tyr                                                
                          ...                                             
                             ...                                          
                                Thr                                       
                                   Glu Ile                                
                                          Leu                             
                                             ...                          
                                                Gly                       
                                                   Ser                    
                                                      ...                 
                                                         ...              
                                                            ...           
Vgr-1 13     ... ...                                                      
                    Ser                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                ...                                       
                                   Ala His                                
                                          ...                             
                                             ...                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            ...           
CBMP-2A                                                                   
       9     Glu ...                                                      
                    Pro                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                Ala                                       
                                   Asp His                                
                                          Leu                             
                                             ...                          
                                                Ser                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            ...           
CBMP-2B                                                                   
      10     Asp ...                                                      
                    Pro                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                Ala                                       
                                   Asp His                                
                                          Leu                             
                                             ...                          
                                                Ser                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            ...           
BMP3  26     Ala ...                                                      
                    Gln                                                   
                       ...                                                
                          ...                                             
                             Met                                          
                                Pro                                       
                                   Lys Ser                                
                                          Leu                             
                                             Lys                          
                                                Pro                       
                                                   Ser                    
                                                      ...                 
                                                         ...              
                                                            ...           
GDF-1 14     Gln ...                                                      
                    ...                                                   
                       Leu                                                
                          ...                                             
                             Val                                          
                                Ala                                       
                                   Leu Ser                                
                                          Gly                             
                                             Ser**                        
                                                ...                       
                                                   Leu                    
                                                      ...                 
                                                         ...              
                                                            ...           
60A   25     ... ...                                                      
                    Asn                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                ...                                       
                                   Ala His                                
                                          ...                             
                                             ...                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            ...           
BMP5  27     ... ...                                                      
                    Ser                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                ...                                       
                                   Ala His                                
                                          Met                             
                                             ...                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            ...           
BMP6  28     ... ...                                                      
                    Ser                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                ...                                       
                                   Ala His                                
                                          Met                             
                                             ...                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            ...           
                    35             40              45                     
__________________________________________________________________________
      Seq ID No:                                                          
__________________________________________________________________________
hOP-1  5     Ile Val                                                      
                    Gln                                                   
                       Thr                                                
                          Leu                                             
                             Val                                          
                                His                                       
                                   Phe Ile                                
                                          Asn                             
                                             Pro                          
                                                Glu                       
                                                   Thr                    
                                                      Val                 
                                                         Pro              
                                                            Lys           
mOP-1  6     ... ...                                                      
                    ...                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                ...                                       
                                   ... ...                                
                                          ...                             
                                             ...                          
                                                Asp                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            ...           
hOP-2  7     ... Leu                                                      
                    ...                                                   
                       Ser                                                
                          ...                                             
                             ...                                          
                                His                                       
                                   Leu Met                                
                                          Lys                             
                                             ...                          
                                                Asn                       
                                                   Ala                    
                                                      ...                 
                                                         ...              
                                                            ...           
mOP-2  8     ... Leu                                                      
                    ...                                                   
                       Ser                                                
                          ...                                             
                             ...                                          
                                His                                       
                                   Leu Met                                
                                          Lys                             
                                             ...                          
                                                Asp                       
                                                   Val                    
                                                      ...                 
                                                         ...              
                                                            ...           
DPP   11     Val ...                                                      
                    ...                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                Asn                                       
                                   Asn Asn                                
                                          ...                             
                                             ...                          
                                                Gly                       
                                                   Lys                    
                                                      ...                 
                                                         ...              
                                                            ...           
Vgl   12     ... Leu                                                      
                    ...                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                ...                                       
                                   Ser ...                                
                                          Glu                             
                                             ...                          
                                                ...                       
                                                   Asp                    
                                                      Ile                 
                                                         ...              
                                                            Leu           
Vgr-1 13     ... ...                                                      
                    ...                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                ...                                       
                                   Val Met                                
                                          ...                             
                                             ...                          
                                                ...                       
                                                   Tyr                    
                                                      ...                 
                                                         ...              
                                                            ...           
CBMP-2A                                                                   
       9     ... ...                                                      
                    ...                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                Asn                                       
                                   Ser Val                                
                                          ...                             
                                             Ser                          
      Lys    Ile ...                                                      
                    ...                                                   
CBMP-2B                                                                   
      10     ... ...                                                      
                    ...                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                Asn                                       
                                   Ser Val                                
                                          ...                             
                                             Ser                          
      Ser    Ile ...                                                      
                    ...                                                   
BMP3  26     Thr Ile                                                      
                    ...                                                   
                       Ser                                                
                          Ile                                             
                             ...                                          
                                Arg                                       
                                   Ala**                                  
                                       Gly                                
                                          Val                             
                                             Val                          
                                                Pro                       
                                                   Gly                    
                                                      Ile                 
                                                         ...              
                                                            Glu           
GDF-1 14     Val Leu                                                      
                    Arg                                                   
                       Ala                                                
                          ...                                             
                             Met                                          
                                ...                                       
                                   Ala Ala                                
                                          Ala                             
                                             ...                          
                                                Gly                       
                                                   Ala                    
                                                      Ala                 
                                                         Asp              
                                                            Leu           
60A   25     ... ...                                                      
                    ...                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                ...                                       
                                   Leu Leu                                
                                          Glu                             
                                             ...                          
                                                Lys                       
                                                   Lys                    
                                                      ...                 
                                                         ...              
                                                            ...           
BMP5  27     ... ...                                                      
                    ...                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                ...                                       
                                   Leu Met                                
                                          Phe                             
                                             ...                          
                                                Asp                       
                                                   His                    
                                                      ...                 
                                                         ...              
                                                            ...           
BMP6  28     ... ...                                                      
                    ...                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                ...                                       
                                   Leu Met                                
                                          ...                             
                                             ...                          
                                                ...                       
                                                   Tyr                    
                                                      ...                 
                                                         ...              
                                                            ...           
                 50             55              60                        
__________________________________________________________________________
      Seq ID No:                                                          
__________________________________________________________________________
hOP-1  5     Pro Cys                                                      
                    Cys                                                   
                       Ala                                                
                          Pro                                             
                             Thr                                          
                                Gln                                       
                                   Leu Asn                                
                                          Ala                             
                                             Ile                          
                                                Ser                       
                                                   Val                    
                                                      Leu                 
                                                         Tyr              
                                                            Phe           
mOP-1  6     ... ...                                                      
                    ...                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                ...                                       
                                   ... ...                                
                                          ...                             
                                             ...                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            ...           
hOP-2  7     Ala ...                                                      
                    ...                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                Lys                                       
                                   ... Ser                                
                                          ...                             
                                             Thr                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            Tyr           
mOP-2  8     Ala ...                                                      
                    ...                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                Lys                                       
                                   ... Ser                                
                                          ...                             
                                             Thr                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            Tyr           
DPP   11     Ala ...                                                      
                    ...                                                   
                       Val                                                
                          ...                                             
                             ...                                          
                                ...                                       
                                   ... Asp                                
                                          Ser                             
                                             Val                          
                                                Ala                       
                                                   Met                    
                                                      ...                 
                                                         ...              
                                                            Leu           
Vgl   12     ... ...                                                      
                    ...                                                   
                       Val                                                
                          ...                                             
                             ...                                          
                                Lys                                       
                                   Met Ser                                
                                          Pro                             
                                             ...                          
                                                ...                       
                                                   Met                    
                                                      ...                 
                                                         Phe              
                                                            Tyr           
Vgr-1 13     ... ...                                                      
                    ...                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                Lys                                       
                                   Val ...                                
                                          ...                             
                                             ...                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            ...           
CBMP-2A                                                                   
       9     Ala ...                                                      
                    ...                                                   
                       Val                                                
                          ...                                             
                             ...                                          
                                Glu                                       
                                   ... Ser                                
                                          ...                             
                                             ...                          
                                                ...                       
                                                   Met                    
                                                      ...                 
                                                         ...              
                                                            Leu           
CBMP-2B                                                                   
      10     Ala ...                                                      
                    ...                                                   
                       Val                                                
                          ...                                             
                             ...                                          
                                Glu                                       
                                   ... Ser                                
                                          ...                             
                                             ...                          
                                                ...                       
                                                   Met                    
                                                      ...                 
                                                         ...              
                                                            Leu           
BMP3  26     ... ...                                                      
                    ...                                                   
                       Val                                                
                          ...                                             
                             Glu                                          
                                Lys                                       
                                   Met Ser                                
                                          Ser                             
                                             Leu                          
                                                ...                       
                                                   Ile                    
                                                      ...                 
                                                         Phe              
                                                            Tyr           
GDF-1 14     ... ...                                                      
                    ...                                                   
                       Val                                                
                          ...                                             
                             Ala                                          
                                Arg                                       
                                   ... Ser                                
                                          Pro                             
                                             ...                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         Phe              
                                                            ...           
60A   25     ... ...                                                      
                    ...                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                Arg                                       
                                   ... Gly                                
                                          ...                             
                                             Leu                          
                                                Pro                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            His           
BMP5  27     ... ...                                                      
                    ...                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                Lys                                       
                                   ... ...                                
                                          ...                             
                                             ...                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            ...           
BMP6  28     ... ...                                                      
                    ...                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                Lys                                       
                                   ... ...                                
                                          ...                             
                                             ...                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            ...           
             65              70              75             80            
__________________________________________________________________________
      Seq ID No:                                                          
__________________________________________________________________________
hOP-1  5     Asp Asp                                                      
                    Ser                                                   
                       Ser                                                
                          Asn                                             
                             Val                                          
                                Ile                                       
                                   Leu Lys                                
                                          Lys                             
                                             Tyr                          
                                                Arg                       
                                                   Asn                    
                                                      Met                 
                                                         Val              
                                                            Val           
mOP-1  6     ... ...                                                      
                    ...                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                ...                                       
                                   ... ...                                
                                          ...                             
                                             ...                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            ...           
hOP-2  7     ... Ser                                                      
                    ...                                                   
                       Asn                                                
                          ...                                             
                             ...                                          
                                ...                                       
                                   ... Arg                                
                                          ...                             
                                             His                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            ...           
mOP-2  8     ... Ser                                                      
                    ...                                                   
                       Asn                                                
                          ...                                             
                             ...                                          
                                ...                                       
                                   ... Arg                                
                                          ...                             
                                             His                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            ...           
DPP   11     Asn ...                                                      
                    Gln                                                   
                       ...                                                
                          Thr                                             
                             ...                                          
                                Val                                       
                                   ... ...                                
                                          Asn                             
                                             ...                          
                                                Gln                       
                                                   Glu                    
                                                      ...                 
                                                         Thr              
                                                            ...           
Vgl   12     ... Asn                                                      
                    Asn                                                   
                       Asp                                                
                          ...                                             
                             ...                                          
                                Val                                       
                                   ... Arg                                
                                          His                             
                                             ...                          
                                                Glu                       
                                                   ...                    
                                                      ...                 
                                                         Ala              
                                                            ...           
Vgr-1 13     ... ...                                                      
                    Asn                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                ...                                       
                                   ... ...                                
                                          ...                             
                                             ...                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            ...           
CBMP-2A                                                                   
       9     ... Glu                                                      
                    Asn                                                   
                       Glu                                                
                          Lys                                             
                             ...                                          
                                Val                                       
                                   ... ...                                
                                          Asn                             
                                             ...                          
                                                Gln                       
                                                   Asp                    
                                                      ...                 
                                                         ...              
                                                            ...           
CBMP-2B                                                                   
      10     ... Glu                                                      
                    Tyr                                                   
                       Asp                                                
                          Lys                                             
                             ...                                          
                                Val                                       
                                   ... ...                                
                                          Asn                             
                                             ...                          
                                                Gln                       
                                                   Glu                    
                                                      ...                 
                                                         ...              
                                                            ...           
BMP3  26     ... Glu                                                      
                    Asn                                                   
                       Lys                                                
                          ...                                             
                             ...                                          
                                Val                                       
                                   ... ...                                
                                          Val                             
                                             ...                          
                                                Pro                       
                                                   ...                    
                                                      ...                 
                                                         Thr              
                                                            ...           
GDF-1 14     ... Asn                                                      
                    ...                                                   
                       Asp                                                
                          ...                                             
                             ...                                          
                                Val                                       
                                   ... Arg                                
                                          Gln                             
                                             ...                          
                                                Glu                       
                                                   Asp                    
                                                      ...                 
                                                         ...              
                                                            ...           
60A   25     Leu Asn                                                      
                    Asp                                                   
                       Glu                                                
                          ...                                             
                             ...                                          
                                Asn                                       
                                   ... ...                                
                                          ...                             
                                             ...                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         Ile              
                                                            ...           
BMP5  27     ... ...                                                      
                    ...                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                ...                                       
                                   ... ...                                
                                          ...                             
                                             ...                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            ...           
BMP6  28     ... ...                                                      
                    Asn                                                   
                       ...                                                
                          ...                                             
                             ...                                          
                                ...                                       
                                   ... ...                                
                                          ...                             
                                             ...                          
                                                ...                       
                                                   Trp                    
                                                      ...                 
                                                         ...              
                                                            ...           
                          85              90             95               
__________________________________________________________________________
                                       Seq ID No:                         
__________________________________________________________________________
                                  hOP-1                                   
                                        5    Arg                          
                                                Ala                       
                                                   Cys                    
                                                      Gly                 
                                                         Cys              
                                                            His           
                                  mOP-1                                   
                                        6    ...                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            ...           
                                  hOP-2                                   
                                        7    Lys                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            ...           
                                  mOP-2                                   
                                        8    Lys                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            ...           
                                  DPP  11    Val                          
                                                Gly                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            Arg           
                                  Vgl  12    Asp                          
                                                Glu                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            Arg           
                                  Vgr-1                                   
                                       13    ...                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            ...           
                                  CBMP-2A                                 
                                        9    Glu                          
                                                Gly                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            Arg           
                                  CBMP-2B                                 
                                       10    Glu                          
                                                Gly                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            Arg           
                                  BMP3 26    Glu                          
                                                Ser                       
                                                   ...                    
                                                      Ala                 
                                                         ...              
                                                            Arg           
                                  GDF-1                                   
                                       14    Asp                          
                                                Glu                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            Arg           
                                  60A  25    Lys                          
                                                Ser                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            ...           
                                  BMP5 27    ...                          
                                                Ser                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            ...           
                                  BMP6 28    ...                          
                                                ...                       
                                                   ...                    
                                                      ...                 
                                                         ...              
                                                            ...           
                                                      100   102           
__________________________________________________________________________
 **Between residues 56 and 57 of BMP3 (Seq. ID No. 26) is a Val residue;  
 between residues 43 and 44 of GDF1 (Seq. ID No. 14) lies the amino acid  
 sequence Gly--Gly--Pro--Pro.                                             
As is apparent from the foregoing amino acid sequence comparisons, significant amino acid changes can be made within the generic sequences while retaining the morphogenic activity. For example, while the GDF-1 protein sequence depicted in Table II shares only about 50% amino acid identity with the hoP1 sequence described therein, the GDF-1 sequence shares greater than 70% amino acid sequence homology (or "similarity") with the hOP1 sequence, where "homology" or "similarity" includes allowed conservative amino acid changes within the sequence as defined by Dayoff, et al., Atlas of Protein Sequence and Structure vol.5, supp.3, pp.345-362, (M. O. Dayoff, ed., Nat'l BioMed. Res. Fd'n, Washington D.C. 1979.)
As is apparent from the foregoing amino acid sequence comparisons, significant amino acid changes can be made within the generic sequences while retaining the morphogenic activity. For example, while the GDF-l protein sequence (Seq ID No. 14) depicted in Table II shares only about 50% amino acid identity with the hOP1 sequence (Seq. ID No. 5) described therein, the GDF-1 sequence shares greater than 70% amino acid sequence homology (or "similarity") with the hOP1 sequence, where "homology" or "similarity" includes allowed conservative amino acid changes within the sequence as defined by Dayoff, et al., Atlas of Protein Sequence and Structure vol.5, supp.3, pp.345-362, (M. O. Dayoff, ed., Nat'l BioMed. Res. Fd'n, Washington D.C. 1979.)
The currently most preferred protein sequences useful as morphogens in this invention include those having greater than 60% identity, preferably greater than 65% identity, with the amino acid sequence defining the conserved six cysteine skeleton of hOP1 (e.g., residues 43-139 of Seq. ID No. 5). These most preferred sequences include both allelic and species variants of the OP-1 and OP-2 proteins (Seq. ID Nos. 5-8), including the Drosophila 60A protein (e.g. Seq. ID No. 25). Accordingly, in still another preferred aspect, the invention includes morphogens comprising species of polypeptide chains having the generic amino acid sequence referred to herein as "OPX" (Seq. ID No. 29), which defines the seven cysteine skeleton and accommodates the identities between the various identified mouse and human OP1 and OP2 proteins (Seq. ID Nos. 5-8). Each Xaa at a given position in OPX (Seq. ID No. 28) independently is selected from the residues occurring at the corresponding position in the C-terminal sequence of mouse or human OP1 or OP2 (see Seq. ID Nos. 5-8 and/or Seq. ID Nos. 16-23).
II. Matrix Considerations
The morphogens of this invention may be implanted surgically, dispersed in a biocompatible, preferably in vivo biodegradable matrix appropriately modified to provide a structure in which the morphogen may be dispersed and which allows the influx, differentiation and proliferation of migrating progenitor cells. Alternatively, or, in addition, differentiated hepatocytes and/or hepatocytic progenitor cells, stimulated by exposure to the morphogen, may be disposed in and attached to a matrix structure and implanted surgically. In certain applications, such as where tissue morphogenesis is to be induced in the absence of endogenous tissue-specificity directing signals, the matrix preferably also provides signals capable of directing the tissue specificity of the differentiating cells, and provides a morphogenically permissive environment, being essentially free of growth inhibiting signals.
Where the matrix is to be incorporated into a surgically prepared liver, or provided to a biocompatible, associated site, the formulated matrix on which the morphogen is disposed may be shaped as desired in anticipation of surgery or may be shaped by the physician or technician during surgery. Where cells are to be attached to the matrix before implantation, the matrix preferably is shaped before cells are attached thereto. The matrix preferably is biodegradable in vivo, being slowly absorbed by the body and replaced by new tissue growth, in the shape or very nearly in the shape of the implant.
Details of how to make and how to use preferred matrices useful in this invention are disclosed below. In addition to these matrices, WO 88/03785, published Jun. 2, 1988, and WO90/12604, published Nov. 1, 1990, describe additional polymeric materials and matrix scaffold considerations. The disclosures of these publications are incorporated herein by reference.
A. Tissue-Derived Matrices
Suitable biocompatible, in vivo biodegradable acellular matrices may be prepared from naturally-occurring tissue. The tissue is treated with suitable agents to substantially extract the cellular, nonstructural components of the tissue. The agents also should be capable of extracting any growth inhibiting components associated with the tissue. The resulting material is a porous, acellular matrix, substantially depleted in nonstructurally-associated components, and preferably containing structural molecules such as collagen, laminin, hyaluronic acid, and the like.
The matrix also may be further treated with agents that modify the matrix, increasing the number of pores and micropits on its surfaces. Those skilled in the art will know how to determine which agents are best suited to the extraction of nonstructural components for different tissues. For example, soft tissues such as liver and lung may be thin-sectioned and exposed to a nonpolar solvent such as, for example, 100% ethanol, to destroy the cellular structure of the tissue and extract nonstructural components. The material then is dried and pulverized to yield nonadherent porous particles. Structural tissues such as cartilage and dentin where collagen is the primary component may be demineralized and extracted with guanidine, essentially following the method of Sampath et al. (1983) PNAS 80:6591-6595. For example, pulverized and demineralized dentin is extracted with five volumes of 4M guanidine-HCl, 50 mM Tris-HCl, pH 7.0 for 16 hours at 4° C. The suspension then is filtered. The insoluble material that remains is collected and used to fabricate the matrix. The material is mostly collagenous in manner. It is devoid of morphogenic activity. The matrix particles may further be treated with a collagen fibril-modifying agent that extracts potentially unwanted components from the matrix, and alters the surface structure of the matrix material. Useful agents include acids, organic solvents or heated aqueous media. A detailed description of these matrix treatments are disclosed in U.S. Pat. No. 4,975,526 and PCT publication US90/00912, published Sep. 7, 1990 (WO90/10018).
The currently most preferred agent is a heated aqueous fibril-modifying medium such as water, to increase the matrix particle surface area and porosity. The currently most preferred aqueous medium is an acidic aqueous medium having a pH of less than about 4.5, e.g., within the range of about pH 2-pH 4 which may help to "swell" the collagen before heating. 0.1% acetic acid, which has a pH of about 3, currently is most preferred. 0.1 M acetic acid also may be used.
Various amounts of delipidated, demineralized guanidine-extracted collagen matrix are heated in the aqueous medium (1 g matrix/30 ml aqueous medium) under constant stirring in a water jacketed glass flask, and maintained at a given temperature for a predetermined period of time. Preferred treatment times are about one hour, although exposure times of between about 0.5 to two hours appear acceptable. The temperature employed is held constant at a temperature within the range of about 37° C. to 65° C. The currently preferred heat treatment temperature is within the range of about 45° C to 60° C.
After the heat treatment, the matrix is filtered, washed, lyophilized and used for implant. Where an acidic aqueous medium is used, the matrix also is preferably neutralized prior to washing and lyophilization. A currently preferred neutralization buffer is a 200 mM sodium phosphate buffer, pH 7.0. To neutralize the matrix, the matrix preferably first is allowed to cool following thermal treatment, the acidic aqueous medium (e.g., 0.1% acetic acid) then is removed and replaced with the neutralization buffer and the matrix agitated for about 30 minutes. The neutralization buffer then may be removed and the matrix washed and lyophilized.
Other useful fibril-modifying treatments include acid treatments (e.g., trifluoroacetic acid and hydrogen fluoride) and solvent treatments such as dichloromethane, acetonitrile, isopropanol and chloroform, as well as particular acid/solvent combinations.
After contact with the fibril-modifying agent, the treated matrix may be washed to remove any extracted components, following a form of the procedure set forth below:
1. Suspend matrix preparation in TBS (Tris-buffered saline) 1 g/200 ml and stir at 4° C. for 2 hrs; or in 6 M urea, 50 mM Tris-HCl, 500 mM NaCl, pH 7.0 (UTBS) or water and stir at room temperature (RT) for 30 minutes (sufficient time to neutralize the pH);
2. Centrifuge and repeat wash step; and
3. Centrifuge; discard supernatant; water wash residue; and then lyophilize.
B. Synthetic Matrices
Suitable matrix scaffolds may be created from biocompatible, preferably in vivo biodegradable synthetic polymers, including polylactic acid, polyglycolic acid, polyanhydride, polybutyric acid, and copolymers thereof, and/or synthetic-inorganic materials, such as hydroxyapatite, tricalcium phosphate, and other calcium phospates. These polymers are well described in the art and are available commercially. For example, polymers composed of polyactic acid (e.g., MW 100 kDa), 80% polylactide/20% glycoside or poly 3-hydroxybutyric acid (e.g., MW 30 kDa) all may be purchased from PolySciences, Inc. The polymer compositions generally are obtained in particulate form and the osteogenic devices preferably fabricated under nonaqueous conditions (e.g., in an ethanol-trifluoroacetic acid solution, EtOH/TFA) to avoid hydrolysis of the polymers. In addition, one can alter the morphology of the particulate polymer compositions, for example to increase porosity, using any of a number of particular solvent treatments known in the art.
For example, osteogenic devices fabricated with morphogenic protein, solubilized in EtOH/TFA as described below, and a matrix composed of polylactic acid, poly 3-hydroxybutyric acid, or 80% polylactide/20% glycoside are all osteogenically active when implanted in the rat model and bioassayed as described in U.S. Pat. No. 4,968,590 (e.g., as determined by calcium content, alkaline phosphatase levels and histology of 12-day implants).
C. Synthetic Tissue-Specific Matrices
In addition to the naturally-derived tissue-specific matrices described above, useful tissue-specific matrices may be formulated synthetically if appropriately modified. These porous biocompatible, in vivo biodegradable synthetic matrices are disclosed in PCT publication US91/03603, published Dec. 12, 1991 (WO91/18558), the disclosure of which is hereby incorporated by reference. Briefly, the matrix comprises a porous crosslinked structural polymer of biocompatible, biodegradable collagen and appropriate, tissue-specific glycosaminoglycans as tissue-specific cell attachment factors. Collagen derived from a number of sources may be suitable for use in these synthetic matrices, including insoluble collagen, acid-soluble collagen, collagen soluble in neutral or basic aqueous solutions, as well as those collagens which are commercially available.
Glycosaminoglycans (GAGs) or mucopolysaccharides are hexosamine-containing polysaccharides of animal origin that have a tissue specific distribution, and therefore may be used to help determine the tissue specificity of the morphogen-stimulated differentiating cells. Reaction with the GAGs also provides collagen with another valuable property, i.e., inability to provoke an immune reaction (foreign body reaction) from an animal host.
Chemically, GAGs are made up of residues of hexoseamines glycosidically bound and alternating in a more-or-less regular manner with either hexouronic acid or hexose moieties (see, e.g., Dodgson et al. in Carbohydrate Metabolism and its Disorders (Dickens et al., eds.) Vol. 1, Academic Press (1968)). Useful GAGs include hyaluronic acid, heparin, heparin sulfate, chondroitin 6-sulfate, chondroitin 4-sulfate, dermatan sulfate, and keratin sulfate. Other GAGs are suitable for forming the matrix described herein, and those skilled in the art will either know or be able to ascertain other suitable GAGs using no more than routine experimentation. For a more detailed description of mucopolysaccharides, see Aspinall, Polysaccharides, Pergamon Press, Oxford (1970). For example, as disclosed in U.S. application Ser. No. 529,852, chondroitin-6-sulfate can be used where endochondral bone formation is desired. Heparin sulfate, on the other hand, may be used to formulate synthetic matrices for use in lung tissue repair.
Collagen can be reacted with a GAG in aqueous acidic solutions, preferably in diluted acetic acid solutions. By adding the GAG dropwise into the aqueous collagen dispersion, coprecipitates of tangled collagen fibrils coated with GAG results. This tangled mass of fibers then can be homogenized to form a homogeneous dispersion of fine fibers and then filtered and dried.
Insolubility of the collagen-GAG products can be raised to the desired degree by covalently cross-linking these materials, which also serves to raise the resistance to resorption of these materials. In general, any covalent cross-linking method suitable for cross-linking collagen also is suitable for cross-linking these composite materials, although crosslinking by a dehydrothermal process is preferred.
When dry, the crosslinked particles are essentially spherical, with diameters of about 500 μm. Scanning electron miscroscopy shows pores of about 20 μm on the surface and 40 μm on the interior. The interior is made up of both fibrous and sheet-like structures, providing surfaces for cell attachment. The voids interconnect, providing access to the cells throughout the interior of the particle. The material appears to be roughly 99.5% void volume, making the material very efficient in terms of the potential cell mass that can be grown per gram of microcarrier.
D. Morphogen Adsorption to Matrix Surfaces
The morphogens described herein can be combined and dispersed in a suitable matrix using any of the methods described below:
1. Ethanol Precipitation
Matrix is added to the morphogen dissolved in guanidine-HC1. Samples are vortexed and incubated at a low temperature. Samples are then further vortexed. Cold absolute ethanol is added to the mixture which is then stirred and incubated. After centrifugation (microfuge, high speed) the supernatant is discarded. The matrix is washed with cold concentrated ethanol in water and then lyophilized.
2. Acetonitrile Trifluoroacetic Acid Lyophilization
In this procedure, morphogen in an acetonitrile trifluroacetic acid (ACN/TFA solution is added to the carrier material. Samples are vigorously vortexed many times and then lyophilized.
3. Buffered Saline Lyophilization
Morphogen preparations in physiological saline may also be vortexed with the matrix and lyophilized to produce morphogenically active material.
III. Hepatocytic Cell Considerations
Primary hepatocytes or progenitor cells may be implanted in the mammal in one embodiment of the invention. For example, implanted hepatocytes may act as gene therapy tools capable of correcting a protein deficiency in vivo by expressing and/or secreting the deficient protein when implanted at a liver tissue or associated locus in a mammal. The liver functions in part as a protein-synthesizing organ, responsible for the production of myriad proteins which are secreted from the liver and transported, e.g., via the circulatory system, to function elsewhere in the body. Accordingly, hepatic tissue, like renal and pancreatic tissue, provides an endogenous system having the necessary mechanisms in place to act as a vector for the in vivo production of (including secretion of) any protein, including proteins not normally expressed by hepatic tissue. Thus, protein deficiencies that can be treated by this method include proteins involved in normal liver functions, proteins normally produced and secreted by the liver to function elsewhere in the body, and proteins not normally produced by hepatic tissue. Where the proteins to be produced are not normally expressed by hepatic tissue, the hepatocytes must be provided with means for expressing that protein. For example, the cell may be genetically engineered as described below to induce expression of the endogenous genetic sequence encoding the protein. Alternatively, a nucleic acid encoding the protein and under control of a suitable promoter (and enhancer), may be provided to the cell as described below. In addition, the cell may be provided with one or more regulatory elements so that expression of the protein of interest mimics that of the endogenously produced protein, particularly where normal protein expression depends on changes in the physiological concentration of a molecule. For example, insulin production is regulated by blood glucose levels in the body.
The protein deficiency to be corrected may result from defective endogenous protein production, including protein expression and/or secretion, or the protein's efficacy may be reduced due to a preexisting condition in the individual. The defect may be genetic or may be induced by, for example, damage to the protein-synthesizing tissue. Exemplary hepatic proteins that may be used in a gene therapy include, but are not limited to, albumin and albumin synthesis proteins, blood clotting factors, including fibrinogen and thrombin, Factor VIII, iron or copper binding proteins, and vitamin A binding proteins. Exemplary non-hepatic proteins that may be used in a gene therapy include, but are not limited to, insulin, tissue plasminogen activator (TPA), erythropoietin, growth hormones, and the like. Similarly, the cells also may act as in vivo drug delivery vehicles, capable of producing and secreting one or more therapeutic drugs when implanted at a suitable locus in a mammal. The cells further may be manipulated to modify antigen expression on the cell surface, and limit the in vivo immune response typically induced by foreign material.
Where cells act as gene therapy tools, the cells may be obtained from a donor competent for providing the protein of interest. Cells can be obtained by biopsy or surgical excision from a donor, or from established cell lines. Preferably, allogenic cells are obtained from a biocompatible donor. Alternatively, autologous cells may be obtained from the patient and modified by recombinant DNA technology to incorporate genetic sequences sufficient to allow the cells to produce the protein or proteins of interest in vivo when the cells are reimplanted in the patient. Protocols and detailed discussions of considerations for introducing foreign genetic material into cells, particularly human cells, are well described in the art. A representative, but by no means exhaustive list, includes U.S. Pat.No. 4,868,116, issued Sep. 19, 1989, U.S. Pat. No. 4,980,286, issued Dec. 25, 1990, both to Morgan et al., and U.S. Pat. No. 4,396,601, issued Aug. 2, 1983, to Salser et al., Anderson, WF (1992) Science 256:808-813, Karson et al., (1992) J. Reprod Med 37:508-514, and Hoeg et al., (1990) Trans Assoc. Am Physicians 103:73-79, these disclosures of which are incorporated herein by reference.
A currently preferred protocol for isolating primary hepatocytes from liver tissue is described in Example 3 below. Other methods known in the art also are envisioned to be useful, such as those described, for example, in WO 88/03785. Where pluripotential hemopoietic stem cells are to be used, a useful method for their isolation is described in commonly owned, now-abandoned U.S. Ser. No. 752,764. Briefly, and as described in detail therein, a biocompatible matrix material able to allow the influx of migratory progenitor cells may be implanted at an in vivo site long enough to allow the influx of migratory progenitor cells. For example, a bone-derived, guanidine-extracted matrix, formulated as disclosed for example in Sampath et al. ((1983) PNAS 80:6591-6595), or U.S. Pat. No. 4,975,526, may be implanted into a rat, essentially following the method of Sampath et al. (ibid). After three days the implant is removed, and the progenitor cells associated with the matrix dispersed and cultured. Another method is described, for example, in U.S. Pat. No. 5,061,620, issued Oct. 29, 1991, to Tsukamoto et al.
Isolated cells may be stimulated in vitro by morphogen exposure, essentially as described in Example 3. Stimulation is performed under sterile conditions, using an appropriate morphogen concentration and incubation period to stimulate the cells. Preferred times and concentration for a given procedure may be determined empirically by the clinician without undue experimentation. In general, a period of from about 10 minutes to 72 hours should be sufficient. Cells may be attached to a matrix by incubating the cells in the presence of matrix for at least a number of hours, e.g., 3-5 hours, or, preferably overnight. An efficient technique for attaching cells to a matrix surface is to place a concentrated suspension of cells on the surface of the matrix material and allow the cells to infiltrate and adsorb to the material. Cells typically attach individually or in small groups. In the absence of added morphogen cells begin rearranging into clusters within 24 hours and within 3 days cells have almost completely infiltrated the support and have organized into large clusters.
In a particularly preferred embodiment, the morphogen first is adsorbed to the matrix surface and cells subsequently attached thereto. The cell-matrix structure may be maintained in vitro and to allow the cells to proliferate (preferably by exposure to a morphogen or morphogen-stimulting agent) or, alternatively, the complex may be implanted in the animal and the cells allowed to proliferate (and differentiate) in vivo.
As with morphogen administrations, where implanted cells are to replace damaged or lost tissue at a liver-specific locus, the cells preferably are provided to a surgically prepared locus where from which necrotic or cirrhotic tissue has been removed, e.g., by surgical, chemical, ablating, or other means known in the medical art. The cells then are provided to the prepared site, preferably attached to a matrix and associated with a morphogen or morphogen-stimulating agent.
The cells may be provided to a morphogenically permissive site in a liver-specific locus, e.g., following removal of necrotic and/or cirrhotic tissue, or following excision of sufficient tissue to provide a morphogenically permissive site. Alternatively, the cell-matrix structure may be implanted together with a morphogen or morphogen-stimulating agent at a suitable, vascularized liver-associated locus, such as within the folds of the mesentery.
As described above, implanting cells together with a morphogen or morphogen-stimulating agent enhances their proliferation and their viability in vivo, such that the new tissue is formed without the significant associated cell loss or delay which characterizes existing protocols and which currently require the use of substantial initial seed cell populations. In addition, hepatic tissue growth can be stimulated using the methods described herein without the need of a partial hepatectomy as described in the art. Finally, the morphogens described herein functionally inhibit the tissue damage associated with the body's immune response, reducing the need for associated treatments with immunosuppressive drugs.
IV. Bioassy Considerations
The following sets forth various procedures for evaluating the in vivo morphogenic utility of the morphogens and morphogenic compositions of this invention. The proteins and compositions may be injected or surgically implanted in a mammal, following any of a number of procedures well known in the art.
Histological Evaluation
Histological sectioning and staining is preferred to determine the extent of morphogenesis in vivo, particularly in tissue repair procedures. Excised implants are fixed in Bouins Solution, embedded in paraffin, and cut into 6-8 μm sections. Staining with toluidine blue or hemotoxylin/eosin demonstrates clearly the ultimate development of the new tissue. Twelve day implants are usually sufficient to determine whether the implants contain newly induced tissue.
Successful implants exhibit a controlled progression through the stages of induced tissue development allowing one to identify and follow the tissue-specific events that occur. For example, in endochondral bone formation the stages include: (1) leukocytes on day one; (2) mesenchymal cell migration and proliferation on days two and three; (3) chondrocyte appearance on days five and six; (4) cartilage matrix formation on day seven; (5) cartilage calcification on day eight; (6) vascular invasion, appearance of osteoblasts, and formation of new bone on days nine and ten; (7) appearance of osteoclasts and bone remodeling and dissolution of the implanted matrix on days twelve to eighteen; and (8) hematopoietic bone marrow differentiation in the ossicle on day twenty-one. Similarly, in hepatic tissue formation the stages include leukocytes on day one, mesenchymal cell migration and proliferation on days two and three, hepatocyte appearance on days five and six, followed by matrix formation and vascularization.
Biological Markers
In addition to histological evaluation, biological markers may be used as a marker for tissue morphogenesis. Useful markers include tissue-specific enzymes whose activities may be assayed (e.g., spectrophotometrically) after homogenization of the implant. These assays may be useful for quantitation and for obtaining an estimate of tissue formation quickly after the implants are removed from the animal. For example, alkaline phosphatase activity may be used as a marker for osteogenesis.
Incorporation of systemically provided morphogens may be followed using tagged morphogens (e.g., radioactively labelled) and determining their localization in new tissue, and/or by monitoring their disappearance from the circulatory system using a standard pulse-chase labeling protocol. The morphogen also may be provided with a tissue-specific molecular tag, whose uptake may be monitored and correlated with the concentration of morphogen provided.
V. Formulations and Methods for Parenteral Administration of Therapeutic Agents
The morphogens of this invention may be used to repair diseased or damaged mammalian tissue. The tissue to be repaired is preferably assessed, and excess necrotic or interfering scar tissue removed as needed, by surgical, chemical, ablating or other methods known in the medical arts.
The morphogen then may be provided directly to the tissue locus as part of a sterile, biocompatible composition, either by surgical implantation or injection. Alternatively, a sterile, biocompatible composition containing morphogen-stimulated progenitor cells may be provided to the tissue locus. The existing tissue at the locus, whether diseased or damaged, provides the appropriate matrix to allow the proliferation and tissue-specific differentiation of progenitor cells. In addition, a damaged or diseased tissue locus, particularly one that has been further assaulted by surgical means, provides a morphogenically permissive environment. For some tissues, it is envisioned that systemic provision of the morphogen will be sufficient.
In some circumstances, particularly where tissue damage is extensive, the tissue may not be capable of providing a sufficient matrix for cell influx and proliferation. In these instances, it may be necessary to provide the morphogen or morphogen-stimulated progenitor cells to the tissue locus in association with a suitable, biocompatible formulated matrix, prepared by any of the means described below. The matrix preferably is tissue-specific, in vivo biodegradable, and comprises particles having dimensions within the range of 70-850 μm, most preferably 150-420 μm.
The morphogens may be provided to an individual by any suitable means. Preferably, the morphogen or morphogen-stimulating agent (collectively described herein below as the "therapeutic agent") is provided directly to the liver tissue (e.g., locally, as by injection to the tissue locus or by periodic release from a locally implanted osmotic pump). While not currently preferred for most liver tissue regenerative applications, oral administration or systemic injection also may be viable administration routes for certain applications, such as part of a protocol to enhance viabilty of a tissue to be transplanted, or as part of a protocol to maintain liver function during a surgical or other therapeutic procedure, or for maintaining liver function in aged or immuno-suppressed individuals, or others at risk for hepatic tissue damage. A detailed description of considerations for systemic administration, including oral and parenteral administration, is disclosed, for example, in commonly owned, now-abandoned U.S. Ser. No. 07/938,336, incorporated hereinabove by reference. It should be noted that morphogenically active protein is present in milk, including mammary gland extract, colostrum and 57-day milk, and also is present in human serum, indicating that systemic and, in particular, oral administration are viable administrative routes for morphogens.
Where the morphogen or morphogen-stimulatig agent is provided by local injection, the morphogen preferably comprises part of an aqueous solution. The solution is physiologically acceptable so that in addition to delivery of the desired morphogen to the patient, the solution does not otherwise adversely affect the patient's electrolyte and volume balance. The aqueous medium for the morphogen thus may comprise normal physiologic saline (0.85-0.9% NaCl, 0.15M), pH 7-7.4. The aqueous solution containing the morphogen can be made, for example, by dissolving the protein in 50% ethanol containing acetonitrile in 0.1% trifluoroacetic acid (TFA) or 0.1% HCl, or equivalent solvents. One volume of the resultant solution then is added, for example, to ten volumes of phosphate buffered saline (PBS), which further may include 0.1-0.2% human serum albumin (HSA). The resultant solution preferably is vortexed extensively. If desired, a given morphogen may be made more soluble by association with a suitable molecule. For example, the pro form of the morphogenic protein comprises a species that is soluble in physiologically buffered solutions. In fact, the endogenous protein is thought to be transported in this form. This soluble form of the protein may be obtained from the culture medium of morphogen-secreting mammalian cells. Alternatively, a soluble species may be formulated by complexing the mature dimer (or an active fragment thereof) with part or all of a pro domain. Another molecule capable of enhancing solubility and particularly useful for oral administrations, is casein. For example, addition of 0.2% casein increases solubility of the mature active form of OP-1 by 80%. Other components found in milk and/or various serum proteins also may be useful.
Useful solutions for parenteral administration may be prepared by any of the methods well known in the pharmaceutical art, described, for example, in Remington's Pharmaceutical Sciences (Gennaro, A., ed.), Mack Pub., 1990. Formulations may include, for example, polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, hydrogenated naphthalenes, and the like. Formulations for direct administration, in particular, may include glycerol and other compositions of high viscosity. Biocompatible, preferably bioresorbable, polymers, including, for example, hyaluronic acid, collagen, polybutyrate, tricalcium phosphate, lactide and lactide/glycolide copolymers, may be useful excipients to control the release of the morphogen in vivo. Other potentially useful parenteral delivery systems for these morphogens include ethylene-vinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, and liposomes.
In addition, while the mature forms of certain morphogens described herein typically are sparingly soluble, the morphogen form found in milk (and mammary gland extract and colostrum) is readily soluble, probably by noncovalent association of the mature, morphogenically active form with part or all of the pro domain of the intact sequence and/or by association with one or more milk components. Accordingly, the compounds provided herein also may be associated with molecules capable of enhancing their solubility in vitro or in vivo.
The compounds provided herein also may be associated with molecules capable of targeting the morphogen or morphogen-stimulating agent to liver tissue. For example, an antibody, antibody fragment, or other binding protein that interacts specifically with a surface molecule on liver tissue cells, including hepatocytes or epithelial cells, may be used. Useful targeting molecules may be designed, for example, using the single chain binding site technology disclosed, for example, in U.S. Pat. No. 5,091,513.
As described above, the morphogens provided herein share significant sequence homology in the C-terminal active domains. By contrast, the sequences typically diverge significantly in the sequences which define the pro domain. Accordingly, the pro domain is thought to be morphogen-specific. As described above, it is also known that the various morphogens identified to date are differentially expressed in the different tissues. Accordingly, without being limited to any given theory, it is likely that, under natural conditions in the body, selected morphogens typically act on a given tissue. Accordingly, part or all of the pro domains which have been identified associated with the active form of the morphogen in solution, may serve as targeting molecules for the morphogens described herein. For example, the pro domains may interact specifically with one or more molecules at the target tissue to direct the morphogen associated with the pro domain to that tissue. Accordingly, another useful targeting molecule for targeting morphogen to hepatic tissue may include part or all of a morphogen pro domain. As described above, morphogen species comprising the pro domain may be obtained from culture medium of morphogen-secreting cells. Alternatively, a tissue-targeting species may be formulated by complexing the mature dimer (or an active fragment thereof) with part or all of a pro domain.
Finally, the morphogens or morphogen-stimulating agents provided herein may be administered alone or in combination with other molecules ("cofactors") known to be beneficial in maintaining liver function, particularly symptom-alleviating cofactors, such as other, non-steroidal anti-inflammatory agents, antiseptics and antibiotics.
The compounds provided herein can be formulated into pharmaceutical compositions by admixture with pharmaceutically acceptable nontoxic excipients and carriers. As noted above, such compositions may be prepared for direct, or local or systemic administration, particularly in the form of liquid solutions or suspensions; for oral administration, particularly in the form of tablets or capsules; or intranasally, particularly in the form of powders, nasal drops, or aerosols.
The compositions can be formulated for administration to humans or other mammals in therapeutically effective amounts, e.g., amounts which provide appropriate concentrations for a time sufficient to substantially eliminate or reduce the patient's pathological condition, including stimulating regeneration of damaged or lost hepatic tissue following hepatocellular injury including inhibiting additional damage thereto, to provide therapy for the liver diseases and disorders described above, and amounts effective to protect hepatic tissue in anticipation of injury to the tissue.
As will be appreciated by those skilled in the art, the concentration of the compounds described in a therapeutic composition will vary depending upon a number of factors, including the dosage of the drug to be administered, the chemical characteristics (e.g., hydrophobicity) of the compounds employed, and the route of administration. The preferred dosage of therapeutic agent to be administered also is likely to depend on such variables as the type and extent of progression of the hepatic disorder, the overall health status of the particular patient, the relative biological efficacy of the compound selected, the formulation of the compound excipients, and its route of administration. In general terms, the compounds of this invention may be provided in an aqueous physiological buffer solution containing about 0.001 to 10% w/v compound for liquid administration. Typical dose ranges are from about 10 ng/kg to about 1 g/kg of body weight per day; a preferred dose range is from about 0.1 μg/kg to 100 mg/kg of body weight per day. Optimally, the morphogen dosage given is between 0.1-100 μg of protein per kilogram weight of the patient. No obvious morphogen induced pathological lesions are induced when mature morphogen (e.g., OP-1 e.g., (Seq. ID No. 5 or 6, 20 μg) is administered daily to normal growing rats for 21 consecutive days. Moreover, 10 μg systemic injections of morphogen (e.g., OP-1; Seq. ID No 5 or 6) injected daily for 10 days into normal newborn mice does not produce any gross abnormalties.
Where morphogens are administered systemically, in the methods of the present invention, preferably a large volume loading dose is used at the start of the treatment. The treatment then is continued with a maintenance dose. Further administration then can be determined by monitoring at intervals the levels of the morphogen in the blood.
Where injury to hepatic tissue is induced deliberately as part of, for example, a surgical or other medical procedure, the morphogen preferably is provided just prior to, or concomitant with induction of the trauma. Preferably, the morphogen is administered prophylactically in a surgical setting. Optimally, the morphogen dosage given in all cases is between 1-100 μg of protein per kilogram weight of the patient.
As described above, as an alternative or, in addition, an effective amount of an agent capable of stimulating endogenous morphogen levels may be administered by any of the routes described above. For example, an agent capable of stimulating morphogen production and/or secretion from liver tissue cells or from cells at a distant site which then is targeted to the liver, may be provided to a mammal. A method for identifying and testing agents capable of modulating the levels of endogenous morphogens in a given tissue is described generally herein in Example 9, and in detail in commonly owned U.S. Ser. No. 07/938,021 filed Aug. 28, 1992 and U.S. Ser. No. 752,859, filed Aug. 30, 1991, both now abandoned, the disclosures of which are incorporated herein by reference. Briefly, candidate compounds can be identified and tested by incubating the compound in vitro with a test tissue or cells thereof, for a time sufficient to allow the compound to affect the production, i.e., the expression and/or secretion, of a morphogen produced by the cells of that tissue. Here, suitable tissue or cultured cells of a tissue preferably would comprise hepatic tissue cells.
A currently preferred detection means for evaluating the level of the morphogen in culture upon exposure to the candidate compound comprises an immunoassay utilizing an antibody or other suitable binding protein capable of reacting specifically with a morphogen and being detected as part of a complex with the morphogen. Immunoassays may be performed using standard techniques known in the art and antibodies raised against a morphogen and specific for that morphogen. Agents capable of stimulating endogenous morphogens then may formulated into pharmaceutical preparations and administered as described herein.
VI. EXAMPLES Example 1 Identification of Morphogen-Expressing Tissue
Determining the tissue distribution of morphogens may be used to identify different morphogens expressed in a given tissue, as well as to identify new, related morphogens. Tissue distribution also may be used to identify useful morphogen-producing tissue for use in screening and identifying candidate morphogen-stimulating agents. The morphogens (or their mRNA transcripts) readily are identified in different tissues using standard methodologies and minor modifications thereof in tissues where expression may be low. For example, protein distribution may be determined using standard Western blot analysis or immunofluorescent techniques, and antibodies specific to the morphogen or morphogens of interest. Similarly, the distribution of morphogen transcripts may be determined using standard Northern hybridization protocols and transcript-specific probes.
Any probe capable of hybridizing specifically to a transcript, and distinguishing the transcript of interest from other, related transcripts may be used. Because the morphogens described herein share such high sequence homology in their active, C-terminal domains, the tissue distribution of a specific morphogen transcript may best be determined using a probe specific for the pro region of the immature protein and/or the N-terminal region of the mature protein. Another useful sequence is the 3' non-coding region flanking and immediately following the stop codon. These portions of the sequence vary substantially among the morphogens of this invention, and accordingly, are specific for each protein. For example, a particularly useful Vgr-1-specific probe sequence (e.g., a probe for specific detection of nucleic acid encoding a Seq. ID No. 13 polypeptide) is the PvuII-SacI fragment, a 265 bp fragment encoding both a portion of the untranslated pro region and the N-terminus of the mature sequence (see Lyons et al. (1989) PNAS 86:4554-4558 for a description of the cDNA sequence). Similarly, particularly useful mOP-1-specific probe sequences (e.g., probe sequences for detecting nucleic acids corresponding to the prodomain sequence in Seq. ID No. 18) are the BstX1-BglI fragment, a 0.68 Kb sequence that covers approximately two-thirds of the mOP-1 pro region; a StuI-StuI fragment, a 0.2 Kb sequence immediately upstream of the 7-cysteine domain; and the Earl-Pst1 fragment, an 0.3 Kb fragment containing a portion of the 3' untranslated sequence. Similar approaches may be used, for example, with hOP-1 (Seq. ID No. 16) or human or mouse OP-2 (Seq. ID Nos. 20 and 22, respectively).
Using these morphogen-specific probes, which may be synthetically engineered or obtained from cloned sequences, morphogen transcripts can be identified in mammalian tissue, using standard methodologies well known to those having ordinary skill in the art. Briefly, total RNA is prepared from various adult murine tissues (e.g., liver, kidney, testis, heart, brain, thymus and stomach) by a standard methodology such as by the method of Chomczyaski et al. ((1987) Anal. Biochem 162:156-159) and described below. Poly (A)+RNA is prepared by using oligo (dT)-cellulose chromatography (e.g., Type 7, from Pharmacia LKB Biotechnology, Inc.). Poly (A)+RNA (generally 15 μg) from each tissue is fractionated on a 1% agarose/formaldehyde gel and transferred onto a Nytran membrane (Schleicher & Schuell). Following the transfer, the membrane is baked at 80° C. and the RNA is cross-linked under UV light (generally 30 seconds at 1 mW/cm2). Prior to hybridization, the appropriate probe is denatured by heating. The hybridization is carried out in a lucite cylinder rotating in a roller bottle apparatus at approximately 1 rev/min for approximately 15 hours at 37° C. using a hybridization mix of 40% formamide, 5×Denhardts, 5×SSPE, and 0.1% SDS. Following hybridization, the non-specific counts are washed off the filters in 0.1×SSPE, 0.1% SDS at 50° C.
Examples demonstrating the tissue distribution of various morphogens, including Vgr-1, OP-1, BMP2, BMP3, BMP4, BMP5, GDF-1, and OP-2 (e.g., Seq. ID Nos. 13, 5, 9, 26, 10, 27, 14 and 6, respectively) in developing and adult tissue are disclosed in commonly owned, now abandoned U.S. Ser. No. 752,764, and in Ozkaynak, et al., (1991) Biochem. Biophys. Res. Commn. 179:116-123, and Ozkaynak, et al. (1992) J. Biol. Chem., press), the disclosures of which are incorporated herein by reference. Using the general probing methodology described herein, northern blot hybridizations using probes specific for these morphogens to probe brain, spleen, lung, heart, liver and kidney tissue indicate that kidney-related tissue appears to be the primary expression source for OP-1 (comprising, e.g., Seq. ID No. 5), with brain, heart and lung tissues being secondary sources. Lung tissue appears to be the primary tissue expression source for Vgr-1, BMP5, BMP4 and BMP3 (comprising respectively, e.g., Seq. ID Nos. 13, 27, 10 and 26) Lower levels of Vgr-1 (comprising, ;e.g., Seq. ID No. 13) also are seen in kidney and heart tissue, while the liver appears to be a secondary expression source for BMP5, (comprising, e.g., Seq. ID No. 27) and the spleen appears to be a secondary expression source for BMP4 (comprising, e.g., Seq. ID No. 10). GDF-1 (comprising, e.g., Seq. ID No. 14) appears to be expressed primarily in brain tissue. To date, OP-2 (comprising, e.g., Seq. ID No. 7) appears to be expressed primarily in early embryonic tissue. Specifically, northern blots of murine embryos and 6-day post-natal animals shows abundant OP2 expression in 8-day embryos. Expression is reduced significantly in 17-day embryos and is not detected in post-natal animals.
Example 2 Morphogen Localization in Developing Hepatic Tissue
The onset of liver formation in a developing embryo occurs at day 14. Using the hybridization protocol described in Example 1, morphogen expression was identified at the onset of liver formation during embryo development. Specifically, northern blots of mRNA isolated from murine embryo liver tissue (probed at 15 days and 20 days) and post natal mouse liver tissue (probed at 7, 14, 21 and 28 days past birth) show mOP-1 (e.g., Seq. ID No. 18) expression in developing liver tissue only during the time of liver formation. Specifically, as illustrated, in FIG. 1, mOP-1 RNA (e.g., RNA complementary to Seq. ID No. 18) is expressed significantly in the 15 day embryo, and is present at much lower amounts at later times in healthy hepatic tissue. In the figure, lanes 2 and 3 contain RNA from 15- and 20-day embryo tissue, lanes 4-8, RNA from 3, 7, 14, 21 and 28 days post natal animals, and lane 8 is a molecular weight ladder. Lanes 1 and 9 are markers. mOP-1 RNA (e.g., complementary to Seq. ID No. 18) appears as a discrete band running at about 4 kb and 2.2 or 2.4 kb, as well as a shorter band at 1.8 kb (see, for example, Ozkaznak, et al. (1991) Biochem. Biophys Res. 179: 116-123.
Example 3 Mitogenic Effect of Morphogen on Rat Hepatocytes
The ability of a morphogen to induce proliferation of primary hepatocytes may be demonstrated in vitro using the following assay using primary hepatocytes isolated from rat liver. Unless otherwise indicated, all chemicals referenced are standard, commercially available reagents, readily available from a number of sources, including Sigma Chemical, Co., St. Louis; Calbiochem, Corp., San Diego, and Aldrich Chemical Co., Milwaukee.
Rat primary hepatocyte cultures were prepared by a two-step collagenase digestion essentially as described by Fausto et al. (1987) Cell Separation: Methods and Selected Applications 4:45-77 the disclosure of which is incorporated herein by reference. Briefly, the liver of a male rat (e.g., CD strain, Charles River Laboratories, Wilmington, Mass.) was perfused via the portal vein with Ca2+ free and Mg2+ free Hank's balanced salt solution for 10 min at a flow of 30-40 ml/min, followed by perfusion with 0.05% collagenase in Ca2+ -containing medium (Hepes buffer) for 10 min. The liver capsule was removed, the cells shaken loose from the tissue and filtered hepatocytes were collected by repeated centrifugation of the cell suspension at 50 xg for 25 min. Hepatocyte suspensions were virtually free of non-parenchymal cell contamination. Cells (2×105 per dish) were plated on 35-mm dishes coated with rat tail collagen in MEM (modified Eagle's Medium, Gibco, Long Island) containing 5% fetal bovine serum (FBS), 1 mM pyuvate, 0.2 mM aspartate, 1 mM proline, 0.2 mM serine, 2 mM glutamine, and 0.5 μg of hydrocotisone and 1 μg of insulin per ml. The cells were incubated for 24 hours under standard at 37° C., at which time the growth medium was replaced with serum-free MEM.
The cell culture then was divided into two groups: (1) wells which received morphogen within the dose range of 1-100 ng of morphogen per ml medium; and (2) the control group, which received no additional factors. In this example, OP-1 (e.g., Seq. ID No. 5) was the morphogen tested. The cells then were incubated for an additional 18-24 hours after which the wells were pulsed with 2 μCi/well of 3 H-thymidine and incubated for six more hours. The excess label then was washed off with a cold solution of 0.15 M NaCl. 250 μl of 10% tricholoracetic acid then was added to each well and the wells incubated at room temperature for 30 minutes. The cells then were washed three times with cold distilled water, and lysed by the addition of 250 μl of 1% sodium dodecyl sulfate (SDS) for a period of 30 minutes at 37° C. The cell lysates then were harvested using standard means well known in the art, and the incorporation of 3 H-thymidine into cellular DNA was determined by liquid scintillation as an indication of mitogenic activity of the cells.
Morphogen treatment of primary hepatocyte cultures significantly stimulates 3 H-thymidine incorporation into DNA, and thus promotes their cell proliferation. The mitogenesis stimulated by 20 ng of OP-1 (e.g., Seq. ID No. 5) in 1 ml serum-free medium was equivalent to the mitogenic effect of 10% fresh serum alone. By contrast, other local-acting growth factors, such as TGF-β do not stimulate proliferation of primary hepatocytes (see Fausto et al. (1991) Ciba Found Symp 157:165-174.)
Example 4 Morphogen-Induced Liver Regeneration
While hepatocytes have a remarkable capacity to undergo compensatory growth following tissue loss, the reparative properties of liver differ significantly from embryonic morphogenesis. Specifically, following a partial hepatectomy wherein a liver lobe is partially or completely removed, the remaining intact lobes grow rapidly and double in weight due to the ability of the differentiated hepatocytes in the intact lobe to undergo limited proliferation. However, the excised lobe itself is not regenerated. The following example demonstrates the ability of morphogens to regenerate lost hepatic tissue following a partial hepatectomy, including regenerating the excised tissue lobe. The protocol described below is a variation on a standard partial hepatectomy protocol, described, for example, by Higgins et al. (1931) Arch. Pathol. 12:136-202 and Braun et al. (1989) PNAS 86:1558-1562, the disclosures of which are incorporated herein by reference.
Morphogen, e.g., purified recombinant human OP-1, mature form (Seq. ID No. 5), was solubilized (1 mg/ml) in 50% ethanol (or compatible solvent) containing 0.1% trifluoroacetic acid (or compatible acid). The injectable OP-1 solution was prepared by diluting one volume of OP-1/solvent-acid stock solution with 9 volumes of 0.2% rat serum albumin in sterile PBS (phosphate-buffered saline).
Growing rats or aged rats were anesthetized by using ketamine. Two of the liver lobes (left and right) were cut out (approximately 1/3 of the lobe) and the morphogen was injected locally at multiple sites along the cut ends. The amount of OP-1 injected was 100 μg in 100 of PBS/RSA (phosphate-buffered saline/rat serum albumin) injection buffer. Placebo samples were injection buffer without OP-1. Five rats in each group were used. The wound was closed using standard surgical procedures and the rats were allowed to eat normal food and drink tap water.
After 12 days, the rats were sacrificed and liver regeneration was observed visually. The photograph in FIG. 2 illustrates dramatically the regenerative effects of OP-1 (e.g., Seq. ID No. 5) on liver tissue formation. In the figure, the arrow indicates the treated lobe. The OP-1-injected group showed complete liver tissue regeneration including reformation of the excised lobe tissue, and showed no sign of any cut in the liver (animal 2). By contrast, in the control group into which only PBS was injected, the excised lobe tissue was not regenerated (animal 1). The original incision remains visible.
In a related experiment, animals were partially hepatectomized or sham-operated and Northern blot analysis performed on RNA isolated from the liver tissue. None of the animals were morphogen-treated. As determined by Northern blot analysis (probed with mOP-1-specific (e.g., Seq. ID No. 18 specific) labeled oligonucleotide, see FIG. 3), in the absence of morphogen treatment, the level of endogenous morphogen is not enhanced significantly following partial hepatectomy. In the FIG. lanes 2, 4, 6, 8, 10, 12, and 14, are samples from partially hepatectomized rats and lanes 3, 5, 7, 9, 11, 13, and 15 are samples from sham-operated rats, and lanes 1 and 16 are markers. Samples were taken at 6 hour intervals between 12 and 96 hours post surgery.
Example 5 Morphogen Expression in Regenerating Liver Tissue Following Toxin-Induced Tissue Damage
Hepatic tissue repair following toxic agent-induced damaged tissue involves proliferation and differentiation of hepatocyte precursor cells. This tissue reparation apparently mimics the tissue morphogenesis cascade that occurs during embryogenesis (Fausto, et al.(1989) Lab.Investigation 60:4-13). As demonstrated in the example below, morphogen expression is enhanced significantly during hepatic tissue regeneration following galactosamine or carbon tetrachloride (CCl4)-induced liver damage. Experiments were performed essentially as described in Kuhlmann et al., (1980) Virchows Arch 387:47-57, the disclosure of which is incorporated herein by reference .
In this experiment, male rats were provided with a single intraperitoneal injection of galactosamine-HCl 0.75 g/.kg body weight on day 0, and morphogen expression monitored by standard Northern blot of liver tissue samples taken on days 1-7 and day 10. OP-1 expression (e.g., Seq. ID No. 18 expression) was significantly enhanced during this hepatic tissue regenerative period, indicating that morphogens play a significant role in tissue regeneration. In FIG. 4, lanes 1-8, are samples taken on days 0-7; lane 9 is a sample taken on day 10, and lane 10 contains molecular weight markers. OP-1 mRNA (e.g., complementary to Seq. ID No. 18) shows a significant expression spike on days 3-7. Similar results were seen with tissue regeneration stimulated following CCl4 -induced tissue, wherein CC14 intoxication is induced by orally administering 1.5 g CCl4 /kg body weight. Significant morphogen expression (mOP-1 mRNA, as determined by standard Northern blot) is identified by a hybridization spike at 12 hours and continuing through at least 72 hours.
Example 6 Morphogen Inhibition of Cellular and Humoral Inflammatory Response
The morphogens described herein may be used to alleviate tissue damage associated with immune response-mediated damage to liver tissue. Details of this damage and the use of morphogens to alleviate this injury as well as to provide a cytoprotective effect in anticipation of this injury for example, during a transplant procedure, are disclosed in commonly owned U.S. Ser. No. 07/938,336 and U.S. Ser. No. 07/938,337, both filed Aug. 28, 1992 and now-abandoned, and U.S. Ser. No. 753,059, filed Aug. 30, 1991 (also now abandoned). A primary source of such damage to hepatic tissue results, for example, from reduced perfusion of the hepatic blood supply and/or from partial or complete occlusion of the portal vein. As described in U.S. Ser. Nos. 07/938,336 and in 753,059, morphogens have been shown to alleviate damage to myocardial tissue following ischemia-reperfusion injury. The morphogens also alleivate analogous tissue damage to hepatic tissue.
Morphogens described herein inhibit multinucleation of mononuclear phagocytic cells under conditions where these cells normally would be activated, e.g., in response to a tissue injury or the presence of a foreign substance. For example, in the absence of morphogen, an implanted substrate material (e.g., implanted subcutaneously) composed of, for example, mineralized bone, a ceramic such as titanium oxide or any other substrate that provokes multinucleated giant cell formation, rapidly becomes surrounded by multinucleated giant cells, e.g., activated phagocytes stimulated to respond and destroy the foreign object. In the presence of morphogen however, the recruited cells remain in their mononuclear precursor form and the matrix material is undisturbed. FIG. 5 illustrates this effect of morphogens, in a schematic representation of histology results of a titanium oxide substrate implanted subcutaneously. In the figure, "mg" means multinucleated giant cells and "ob" means osteoblasts. The substrate represented in FIG. 5B was implanted together with morphogen (OP-1; e.g., Seq. ID No. 5) and newly formed osteoblasts are evident surrounding the substrate. By contrast, the substrate represented in FIG. 5A was implanted without morphogen and extensive multinucleated giant cell formation is evident surrounding the substrate. Accordingly, the morphogens' effect in a mammal also may include inhibiting activation of these giant cells.
In addition, the morphogens described herein also suppress antibody production stimulated in response to a foreign antigen in a mammal. Specifically, when bovine bone collagen matrix alone was implanted in a bony site in a rat, a standard antibody response to the collagen is stimulated in the rat as determined by standard anti-bovine collagen ELISA experiments performed on blood samples taken at four week intervals following implantation (e.g., between 12 and 20 weeks.) Serum anti-collagen antibody titers, measured by ELISA essentially following the procedure described by Nagler-Anderson et al, (1986) PNAS 83:7443-7446, the disclosure of which is incorporated herein by reference, increased consistently throughout the experiment. However, when the matrix was implanted together with a morphogen (e.g., OP-1 Seq. ID No. 5, dispersed in the matrix and adsorbed thereto, essentially as described in U.S. Pat. No. 4,968,590) anti-bovine collagen antibody production was suppressed significantly. This ability of morphogen to suppress the humoral response is further evidence of morphogen utility in alleviating tissue damage.
Example 7 Morphogen Effect on Fibrogenesis and Scar Tissue Formation
The morphogens described herein induce tissue morphogenesis of damaged or lost tissue. The ability of these proteins to regenerate new tissue also is enhanced by the anti-inflammatory effect of these proteins. Provided below are a series of in vitro experiments demonstrating the ability of morphogens to induce migration and accumulation of mesenchymal cells. In addition, the experiments demonstrate that morphogens, unlike TGF-β, do not stimulate fibrogenesis or scar tissue formation. Specifically, morphogens do not stimulate production of collagen, hyaluronic acid (HA) or metalloproteinases in primary fibroblasts, all of which are required for fibrogenesis or scar tissue formation. By contrast, TGF-β, a known inducer of fibrosis, but not of tissue morphogenesis as described herein, does stimulate production of these fibrosis markers.
Chemotaxis and migration of mesenchymal progenitor cells were measured in modified Boyden chambers essentially as described by Fava, R.A. et al (1991) J. Exp. Med. 173: 1121-1132, the disclosure of which is incorporated herein by reference, using polycarbonate filters of 2, 3 and 8 micron ports to measure migration of progenitor neutrophils, monocytes and fibroblasts. Chemotaxis was measured over a range of morphogen concentrations, e.g., 10-20 M to 10-12 M OP-1 (e.g., Seq. ID No. 5). For progenitor neutrophils and monocytes, 10-18 -10-17 M OP-1 (e.g., Seq. ID No 5) consistently induced maximal migration, and 10-14 to 10-13 M OP-1 (e.g., Seq. ID No. 5) maximally induced migration of progenitor fibroblasts. In all cases the chemotactic activity could be inhibited with anti-OP-1 antibody (e.g., antibody reactive with a Seq. ID No. 5 polypeptide). Similar migration activities also were measured and observed with TGF-β.
The effect of morphogen on fibrogenesis was determined by evaluating fibroblast production of hyaluronic acid (HA), collagen, collagenese and tissue inhibitor of metalloproteinases (TIMP).
Human fibroblasts were established from explants of infant foreskins and maintained in monolayer culture using standard culturing procedures. (See, for example, (1976) J. Exp. Med. 144: 1188-1203.) Briefly, fibroblasts were grown in maintenance medium consisting of Eagle's MEM, supplemented with nonessential amino acids, ascorbic acid (50 μg/ml), NaHCO3 and HEPES buffers (pH 7.2), penicillin (100 U/ml), streptomycin (100 μg/ml), amphotericin B (1 μg/ml) and 9% heat inactivated FCS. Fibroblasts used as target cells to measure chemotaxis were maintained in 150 mm diameter glass petri dishes. Fibroblasts used in assays to measure synthesis of collagen, hyaluronic acid, collagenase and tissue inhibitors of metalloproteinases (TIMP) were grown in 100 mm diameter plastic tissue culture petri dishes.
The effects of morphogen on fibroblast production of hyaluronic acid, collagens, collagenase and TIMP were determined by standard assays (See, for example, Posttethwaite et al. (1989) J. Clin. Invest. 83: 629-636, Posttethwaithe (1988) J./Cell Biol. 106: 311-318 and Clark et al (1985) Arch. Bio-chem Biophys. 241: 36-44, the disclosures of which are incorporated by reference.) For these assays, fibroblasts were transferred to 24-well tissue culture plates at a density of 8×104 cells per well. Fibroblasts were grown to confluency in maintenance medium containing 9% FCS for 72 h and then grown in serum-free maintenance medium for 24 h. Medium was then removed from each well and various concentrations of OP-1 (recombinantly produced mature or soluble form, comprising, e.g., Seq. ID No. 5) or TGF-β-1 (R&D Systems, Minneapolis) in 50 μl PBS were added to triplicate wells containing the confluent fibroblast monolayers. For experiments that measured production of collagenase and TIMP, maintenance medium (450 μl) containing 5% FCS was added to each well, and culture supernatants were harvested from each well 48 h later and stored at -70° C. until assayed. For experiments that assessed HA production, maintenance medium (450 μl) containing 2.5% FCS was added to each well, and cultures grown for 48 h. For experiments that measured fibroblast production of collagens, serum-free maintenance medium (450 μl) without non-essential amino acids was added to each well and cultures grown for 72 h. Fibroblast production of HA was measured by labeling newly synthesized glycosaminoglycans (GAG) with 3 H!-acetate during the last 24 h of culture and quantitating released radioactivity after incubation with hyaluronidase from Streptomyces hyalurolyticus (ICN Biochemicals, Cleveland, Ohio) which specifically degrades hyaluronic acid. Production of total collagen by fibroblasts was measured using a collagenase-sensitive protein assay that reflects 3 H!-proline incorporation the last 24 h of culture into newly synthesized collagens. Collagenase and TIMP protein levels in fibroblast cultures supernatants was measured by specific ELISAs.
As shown in FIG. 6, OP1 (e.g., Seq. ID No. 5) does not stimulate significant collagen or HA production, as compared with TGF-β. In the figure, panel A shows OP-1 (e.g., Seq. ID No. 5) effect on collagen production, panel B shows TGF-β effect on collagen production, and panels C and D show OP-1 (e.g., Seq. ID No. 5; Panel C) and TGF-β (panel D) effect on HA production. The morphogen results were the same whether the soluble or mature form of OP1 (comprising, e.g., Seq. ID No. 5) was used. By contrast, the latent form of TGF-β (e.g., pro domain-associated form of TGF-β) was not active.
Example 8 Liver Tissue Diagnostics
Morphogen localization in developing and regenerating liver tissue can be used as part of a method for diagnosing a liver function disorder in vivo. The method may be particularly advantageous for diagnosing early stages of a liver dysfunction associated with a hepatocellular injury. Specifically, a biopsy of liver tissue is performed on a patient at risk, using standard procedures known in the medical art. Morphogen expression associated with the biopsied tissue then is assessed using standard methodologies, as by immunolocalization, using standard immunofluorescence techniques in concert with morphogen-specific antisera or monoclonal antibodies. Specifically, the biopsied tissue is thin sectioned using standard methodologies known in the art, and fluorescently labelled (or otherwise detectable) antibodies incubated with the tissue under conditions sufficient to allow specific antigen-antibody complex formation. The presence and quantity of complex formed then is detected and compared with a predetermined standard or reference value. Detection of altered levels of morphogen present in the tissue then may be used as an indicator of tissue dysfunction. Alternatively, fluctuation in morphogen levels may be assessed by monitoring morphogen transcription levels, either by standard Northern blot analysis or in situ hybridization, using a labelled probe capable of hybridizing specifically to morphogen RNA and standard RNA hybridization protocols well described in the art and as described in Examples 1, 2, 5 and 6.
Fluctuations in morphogen levels present in the bloodstream or peritoneal fluid also may be used to evaluate liver tissue viability. For example, morphogens are detected associated with regenerating liver tissue and/or may be released from dying cells into surrounding peritoneal fluid. OP-1 (comprising, e.g., Seq. ID No. 5) recently has been identified in human blood, which also may be a means of morphogen transport.
Serum samples may be obtained by standard venipuncture and serum prepared by centrifugation at 3,000 RPM for ten minutes. Similarly, peritoneal fluid samples may be obtained by a standard fluid extraction methodology. The presence of morphogen in the serum or peritoneal fluid then may be assessed by standard Western blot (immunoblot), ELISA or RIA procedures. Briefly, for example, with the ELISA, samples may be diluted in an appropriate buffer, such as phosphate-buffered saline, and 50 μl aliquots allowed to absorb to flat bottomed wells in microtitre plates pre-coated with morphogen-specific antibody, and allowed to incubate for 18 hours at 4° C. Plates then may be washed with a standard buffer and incubated with 50 μl aliquots of a second morphogen-specific antibody conjugated with a detecting agent, e.g., biotin, in an appropriate buffer, for 90 minutes at room temperature. Morphogen-antibody complexes then may be detected using standard procedures.
Alternatively, a morphogen-specific affinity column may be created using, for example, morphogen-specific antibodies adsorbed to a column matrix, and passing the fluid sample through the matrix to selectively extract the morphogen of interest. The morphogen then is eluted. A suitable elution buffer may be determined empirically by determining appropriate binding and elution conditions first with a control (e.g., purified, recombinantly-produced morphogen.) Fractions then are tested for the presence of the morphogen by standard immunoblot. Morphogen concentrations in serum or other fluid samples then may be determined using standard protein quantification techniques, including by spectrophotometric absorbance or by quantitation by ELISA or RIA antibody assays. Using this procedure, OP-1 (comprising, e.g., Seq. ID No. 5) has been identified in serum.
OP-1 (comprising, e.g., Seq. ID No. 5) was detected in human serum using the following assay. A monoclonal antibody raised against mammalian, recombinantly produced OP-1 (e.g., Seq. ID No. 5) using standard immunology techniques well described in the art and described generally in Example 13, was immobilized by passing the antibody over an activated agarose gel (e.g., Affi-Gel™, from Bio-Rad Laboratories, Richmond, Calif., prepared following manufacturer's instructions), and used to purify OP-1 from serum. Human serum then was passed over the column and eluted with 3M K-thiocyanate. K-thiocyanante fractions then were dialyzed in 6M urea, 20 mM PO4, pH 7.0, applied to a C8 HPLC column, and eluted with a 20 minute, 25-50% acetonitrile/0.1% TFA gradient. Mature, recombinantly produced OP-1 (e.g., Seq. ID No. 5) homodimers elute between 20-22 minutes. Accordingly, these fractions from the affinity-purified human serum sample were collected and tested for the presence of OP-1 (e.g., Seq. ID No. 5) by standard immunoblot using an OP-1-specifc antibody, and the protein identity confirmed by N-terminal sequencing.
Morphogens may be used in diagnostic applications by comparing the quantity of morphogen present in a body fluid sample with a predetermined reference value, with fluctuations in fluid morphogen levels indicating a change in the status of liver tissue. Alternatively, fluctuations in the level of endogenous morphogen antibodies may be detected by this method, most likely in serum, using an antibody or other binding protein capable of interacting specifically with the endogenous morphogen antibody. Detected fluctuations in the levels of the endogenous antibody may be used as indicators of a change in tissue status.
Example 9 Screening Assay for Candidate Compounds which Alter Endogenous Morphogen Levels
Candidate compound(s) which may be administered to affect the level of a given morphogen may be found using the following screening assay, in which the level of morphogen production by a cell type which produces measurable levels of the morphogen is determined with and without incubating the cell in culture with the compound, in order to assess the effects of the compound on the cell's production of morphogen. This can be accomplished by detection of the morphogen either at the protein or RNA level. A more detailed description also may be found in commonly owned, now abandoned U.S. Ser. No. 752,861, incorporated hereinabove by reference.
9.1 Growth of Cells in Culture
Cell cultures of kidney, adrenals, urinary bladder, brain, or other organs, may be prepared as described widely in the literature. For example, kidneys may be explanted from neonatal or new born or young or adult rodents (mouse or rat) and used in organ culture as whole or sliced (1-4 mm) tissues. Primary tissue cultures and established cell lines, also derived from kidney, adrenals, urinary, bladder, brain, mammary, or other tissues may be established in multiwell plates (6 well or 24 well) according to conventional cell culture techniques, and are cultured in the absence or presence of serum for a period of time (1-7 days). Cells may be cultured, for example, in Dulbecco's Modified Eagle medium (Gibco, Long Island, N.Y.) containing serum (e.g., fetal calf serum at 1%-10%, Gibco) or in serum-deprived medium, as desired, or in defined medium (e.g., containing insulin, transferrin, glucose, albumin, or other growth factors).
Samples for testing the level of morphogen production include culture supernatants or cell lysates, collected periodically and evaluated for OP-1 (comprising, e.g., Seq. ID No. 6) production by immunoblot analysis (Sambrook et al., eds., 1989, Molecular Cloning, Cold Spring Harbor Press, Cold Spring Harbor, N.Y.), or a portion of the cell culture itself, collected periodically and used to prepare polyA+ RNA for mRNA analysis. To monitor de novo OP-1 (e.g., Seq. ID No. 6) synthesis, some cultures are labeled according to conventional procedures with an 3 5 S-methionine/3 5 S-cysteine mixture for 6-24 hours and then evaluated for OP-1 (e.g., Seq. ID No. 6) synthesis by conventional immunoprecipitation methods.
9.2 Determination of Level of Morphogenic Protein
In order to quantitate the production of a morphogenic protein by a cell type, an immunoassay may be performed to detect the morphogen using a polyclonal or monoclonal antibody specific for that protein. For example, OP-1 (comprising, e.g., Seq. ID No. 5) may be detected using a polyclonal antibody specific for OP-1 (e.g., specific for a Seq. ID No. 5 polypeptide) in an ELISA, as follows.
1 μg/100 μl of affinity-purified polyclonal rabbit IgG specific for OP-1 (e.g., Seq. ID No. 5) is added to each well of a 96-well plate and incubated at 37° C. for an hour. The wells are washed four times with 0.167M sodium borate buffer with 0.15M NaCl (BSB), pH 8.2, containing 0.1% Tween 20. To minimize non-specific binding, the wells are blocked by filling completely with 1% bovine serum albumin (BSA) in BSB and incubating for 1 hour at 37° C. The wells are then washed four times with BSB containing 0.1% Tween 20. A 100 μl aliquot of an appropriate dilution of each of the test samples of cell culture supernatant is added to each well in triplicate and incubated at 37° C. for 30 min. After incubation, 100 μl biotinylated rabbit anti-OP-1 (e.g., Anti-Seq. ID No. 5) serum (stock solution is about 1 mg/ml and diluted 1:400 in BSB containing 1% BSA before use) is added to each well and incubated at 37° C. for 30 min. The wells are then washed four times with BSB containing 0.1% Tween 20. 100 μl strepavidin-alkaline (Southern Biotechnology Associates, Inc. Birmingham, Ala., diluted 1:2000 in BSB containing 0.1% Tween 20 before use) is added to each well and incubated at 37° C. for 30 min. The plates are washed four times with 0.5M Tris buffered Saline (TBS), pH 7.2. 50 μl substrate (ELISA Amplification System Kit, Life Technologies, Inc., Bethesda, Md.) is added to each well and incubated at room temperature for 15 min. Then, 50 μl amplifier (from the same amplification system kit) is added and incubated for another 15 min at room temperature. The reaction is stopped by the addition of 50 μl 0.3M sulphuric acid. The OD at 490 nm of the solution in each well is recorded. To quantitate OP-1 (e.g., Seq. ID No. 5) in culture media, an OP-1 standard curve is performed in parallel with the test samples.
Polyclonal antibody may be prepared as follows. Each rabbit is given a primary immunization of 100 ug/500 μl E. coli produced OP-1 monomer (having an amino acid sequence of residues 328-431 in SEQ ID NO:17) in 0.1% SDS mixed with 500 μl Complete Freund's Adjuvant. The antigen is injected subcutaneously at multiple sites on the back and flanks of the animal. The rabbit is boosted after a month in the same manner using incomplete Freund's Adjuvant. Test bleeds are taken from the ear vein seven days later. Two additional boosts and test bleeds are performed at monthly intervals until antibody against OP-1 (e.g., against the Seq. ID No. 17 polypeptide) is detected in the serum using an ELISA assay. Then, the rabbit is boosted monthly with 100 μg of antigen and bled (15 ml per bleed) at days seven and ten after boosting.
Monoclonal antibody specific for a given morphogen may be prepared as follows. A mouse is given two injections of E. coli produced OP-1 (e.g., Seq. ID No. 17) monomer. The first injection contains 100 μg of OP-1 in complete Freund's adjuvant and is given subcutaneously. The second injection contains 50 μg of OP-1 in incomplete adjuvant and is given intraperitoneally. The mouse then receives a total of 230 μg of OP-1 polypeptide (having the amino acid sequence of residues 307-431 in SEQ ID NO:17) in four intraperitoneal injections at various times over an eight month period. One week prior to fusion, the mouse is boosted intraperitoneally with 100 μg of OP-1 (Seq. ID No. 17, residues 307-431) and 30 μg of the N-terminal peptide (Ser293 -Asn309 -Cys) conjugated through the added cysteine to bovine serum albumin with SMCC crosslinking agent. This boost was repeated five days (IP), four days (IP), three days (IP) and one day (IV) prior to fusion. The mouse spleen cells are then fused to myeloma (e.g., 653) cells at a ratio of 1:1 using PEG 1500 (Boeringer Mannheim), and the cell fusion is plated and screened for OP-1-specific antibodies using OP-1 (307-431) as antigen. The cell fusion and monoclonal screening then are according to standard procedures well described in standard texts widely available in the art.
The invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. The present embodiments are therefore to be considered in all respects as illustrative and not restrictive, the scope of the invention being indicated by the appended claims rather than by the foregoing description, and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein.
__________________________________________________________________________
SEQUENCE LISTING                                                          
(1) GENERAL INFORMATION:                                                  
(iii) NUMBER OF SEQUENCES: 33                                             
(2) INFORMATION FOR SEQ ID NO:1:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 97 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(ix) FEATURE:                                                             
(A) NAME/KEY: Protein                                                     
(B) LOCATION: 1..97                                                       
(D) OTHER INFORMATION: /label= GENERIC-SEQ-1                              
/note= "EACH XAA INDICATES ONE OF THE 20 NATURALLY                        
OCCURRING L- ISOMER, ALPHA-AMINO ACIDS, OR A DERIVATIVE                   
THEREOF"                                                                  
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:                                   
XaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaa                          
151015                                                                    
XaaXaaXaaXaaXaaXaaXaaXaaCysXaaXaaXaaCysXaaXaaXaa                          
202530                                                                    
XaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaa                          
354045                                                                    
XaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaCysCysXaaXaa                          
505560                                                                    
XaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaa                          
65707580                                                                  
XaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaCysXaaCys                          
859095                                                                    
Xaa                                                                       
(2) INFORMATION FOR SEQ ID NO:2:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 97 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(ix) FEATURE:                                                             
(A) NAME/KEY: Protein                                                     
(B) LOCATION: 1..97                                                       
(D) OTHER INFORMATION: /label= GENERIC-SEQ-2                              
/note= "EACH XAA INDICATES ONE OF THE 20 NATURALLY                        
OCCURING L- ISOMER, ALPHA-AMINO ACIDS, OR A DERIVATIVE                    
THEREOF"                                                                  
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:                                   
XaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaa                          
151015                                                                    
XaaXaaXaaXaaXaaXaaXaaXaaCysXaaXaaXaaCysXaaXaaXaa                          
202530                                                                    
XaaXaaXaaCysXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaa                          
354045                                                                    
XaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaCysCysXaaXaa                          
505560                                                                    
XaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaa                          
65707580                                                                  
XaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaCysXaaCys                          
859095                                                                    
Xaa                                                                       
(2) INFORMATION FOR SEQ ID NO:3:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 97 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(ix) FEATURE:                                                             
(A) NAME/KEY: Protein                                                     
(B) LOCATION: 1..97                                                       
(D) OTHER INFORMATION: /label= GENERIC-SEQ-3                              
/note= "WHEREIN EACH XAA IS INDEPENDENTLY SELECTED FROM                   
A GROUP OF ONE OR MORE SPECIFIED AMINO ACIDS AS DEFINED                   
IN THE SPECIFICATION "                                                    
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:                                   
LeuTyrValXaaPheXaaXaaXaaGlyTrpXaaXaaTrpXaaXaaAla                          
151015                                                                    
ProXaaGlyXaaXaaAlaXaaTyrCysXaaGlyXaaCysXaaXaaPro                          
202530                                                                    
XaaXaaXaaXaaXaaXaaXaaXaaAsnHisAlaXaaXaaXaaXaaLeu                          
354045                                                                    
XaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaCysCysXaaPro                          
505560                                                                    
XaaXaaXaaXaaXaaXaaXaaXaaLeuXaaXaaXaaXaaXaaXaaXaa                          
65707580                                                                  
ValXaaLeuXaaXaaXaaXaaXaaMetXaaValXaaXaaCysGlyCys                          
859095                                                                    
Xaa                                                                       
(2) INFORMATION FOR SEQ ID NO:4:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 102 amino acids                                               
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(ix) FEATURE:                                                             
(A) NAME/KEY: Protein                                                     
(B) LOCATION: 1..102                                                      
(D) OTHER INFORMATION: /label= GENERIC-SEQ-4                              
/note= "WHEREIN EACH XAA IS INDEPENDENTLY SELECTED FROM                   
A GROUP OF ONE OR MORE SPECIFIED AMINO ACIDS AS DEFINED                   
IN THE SPECIFICATION"                                                     
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:                                   
CysXaaXaaXaaXaaLeuTyrValXaaPheXaaXaaXaaGlyTrpXaa                          
151015                                                                    
XaaTrpXaaXaaAlaProXaaGlyXaaXaaAlaXaaTyrCysXaaGly                          
202530                                                                    
XaaCysXaaXaaProXaaXaaXaaXaaXaaXaaXaaXaaAsnHisAla                          
354045                                                                    
XaaXaaXaaXaaLeuXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaa                          
505560                                                                    
XaaCysCysXaaProXaaXaaXaaXaaXaaXaaXaaXaaLeuXaaXaa                          
65707580                                                                  
XaaXaaXaaXaaXaaValXaaLeuXaaXaaXaaXaaXaaMetXaaVal                          
859095                                                                    
XaaXaaCysGlyCysXaa                                                        
100                                                                       
(2) INFORMATION FOR SEQ ID NO:5:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 139 amino acids                                               
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(ix) FEATURE:                                                             
(A) NAME/KEY: Protein                                                     
(B) LOCATION: 1..139                                                      
(D) OTHER INFORMATION: /note= "HOP-1 (MATURE FORM)"                       
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:                                   
SerThrGlySerLysGlnArgSerGlnAsnArgSerLysThrProLys                          
151015                                                                    
AsnGlnGluAlaLeuArgMetAlaAsnValAlaGluAsnSerSerSer                          
202530                                                                    
AspGlnArgGlnAlaCysLysLysHisGluLeuTyrValSerPheArg                          
354045                                                                    
AspLeuGlyTrpGlnAspTrpIleIleAlaProGluGlyTyrAlaAla                          
505560                                                                    
TyrTyrCysGluGlyGluCysAlaPheProLeuAsnSerTyrMetAsn                          
65707580                                                                  
AlaThrAsnHisAlaIleValGlnThrLeuValHisPheIleAsnPro                          
859095                                                                    
GluThrValProLysProCysCysAlaProThrGlnLeuAsnAlaIle                          
100105110                                                                 
SerValLeuTyrPheAspAspSerSerAsnValIleLeuLysLysTyr                          
115120125                                                                 
ArgAsnMetValValArgAlaCysGlyCysHis                                         
130135                                                                    
(2) INFORMATION FOR SEQ ID NO:6:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 139 amino acids                                               
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(ix) FEATURE:                                                             
(A) NAME/KEY: Protein                                                     
(B) LOCATION: 1..139                                                      
(D) OTHER INFORMATION: /note= "MOP-1 (MATURE FORM)"                       
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:                                   
SerThrGlyGlyLysGlnArgSerGlnAsnArgSerLysThrProLys                          
151015                                                                    
AsnGlnGluAlaLeuArgMetAlaSerValAlaGluAsnSerSerSer                          
202530                                                                    
AspGlnArgGlnAlaCysLysLysHisGluLeuTyrValSerPheArg                          
354045                                                                    
AspLeuGlyTrpGlnAspTrpIleIleAlaProGluGlyTyrAlaAla                          
505560                                                                    
TyrTyrCysGluGlyGluCysAlaPheProLeuAsnSerTyrMetAsn                          
65707580                                                                  
AlaThrAsnHisAlaIleValGlnThrLeuValHisPheIleAsnPro                          
859095                                                                    
AspThrValProLysProCysCysAlaProThrGlnLeuAsnAlaIle                          
100105110                                                                 
SerValLeuTyrPheAspAspSerSerAsnValIleLeuLysLysTyr                          
115120125                                                                 
ArgAsnMetValValArgAlaCysGlyCysHis                                         
130135                                                                    
(2) INFORMATION FOR SEQ ID NO:7:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 139 amino acids                                               
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(ix) FEATURE:                                                             
(A) NAME/KEY: Protein                                                     
(B) LOCATION: 1..139                                                      
(D) OTHER INFORMATION: /note= "HOP-2 (MATURE FORM)"                       
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:                                   
AlaValArgProLeuArgArgArgGlnProLysLysSerAsnGluLeu                          
151015                                                                    
ProGlnAlaAsnArgLeuProGlyIlePheAspAspValHisGlySer                          
202530                                                                    
HisGlyArgGlnValCysArgArgHisGluLeuTyrValSerPheGln                          
354045                                                                    
AspLeuGlyTrpLeuAspTrpValIleAlaProGlnGlyTyrSerAla                          
505560                                                                    
TyrTyrCysGluGlyGluCysSerPheProLeuAspSerCysMetAsn                          
65707580                                                                  
AlaThrAsnHisAlaIleLeuGlnSerLeuValHisLeuMetLysPro                          
859095                                                                    
AsnAlaValProLysAlaCysCysAlaProThrLysLeuSerAlaThr                          
100105110                                                                 
SerValLeuTyrTyrAspSerSerAsnAsnValIleLeuArgLysHis                          
115120125                                                                 
ArgAsnMetValValLysAlaCysGlyCysHis                                         
130135                                                                    
(2) INFORMATION FOR SEQ ID NO:8:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 139 amino acids                                               
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(ix) FEATURE:                                                             
(A) NAME/KEY: Protein                                                     
(B) LOCATION: 1..139                                                      
(D) OTHER INFORMATION: /note= "MOP-2 (MATURE FORM)"                       
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:                                   
AlaAlaArgProLeuLysArgArgGlnProLysLysThrAsnGluLeu                          
151015                                                                    
ProHisProAsnLysLeuProGlyIlePheAspAspGlyHisGlySer                          
202530                                                                    
ArgGlyArgGluValCysArgArgHisGluLeuTyrValSerPheArg                          
354045                                                                    
AspLeuGlyTrpLeuAspTrpValIleAlaProGlnGlyTyrSerAla                          
505560                                                                    
TyrTyrCysGluGlyGluCysAlaPheProLeuAspSerCysMetAsn                          
65707580                                                                  
AlaThrAsnHisAlaIleLeuGlnSerLeuValHisLeuMetLysPro                          
859095                                                                    
AspValValProLysAlaCysCysAlaProThrLysLeuSerAlaThr                          
100105110                                                                 
SerValLeuTyrTyrAspSerSerAsnAsnValIleLeuArgLysHis                          
115120125                                                                 
ArgAsnMetValValLysAlaCysGlyCysHis                                         
130135                                                                    
(2) INFORMATION FOR SEQ ID NO:9:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 101 amino acids                                               
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(ix) FEATURE:                                                             
(A) NAME/KEY: Protein                                                     
(B) LOCATION: 1..101                                                      
(D) OTHER INFORMATION: /note= "CBMP-2A(FX)"                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:                                   
CysLysArgHisProLeuTyrValAspPheSerAspValGlyTrpAsn                          
151015                                                                    
AspTrpIleValAlaProProGlyTyrHisAlaPheTyrCysHisGly                          
202530                                                                    
GluCysProPheProLeuAlaAspHisLeuAsnSerThrAsnHisAla                          
354045                                                                    
IleValGlnThrLeuValAsnSerValAsnSerLysIleProLysAla                          
505560                                                                    
CysCysValProThrGluLeuSerAlaIleSerMetLeuTyrLeuAsp                          
65707580                                                                  
GluAsnGluLysValValLeuLysAsnTyrGlnAspMetValValGlu                          
859095                                                                    
GlyCysGlyCysArg                                                           
100                                                                       
(2) INFORMATION FOR SEQ ID NO:10:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 101 amino acids                                               
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(ix) FEATURE:                                                             
(A) NAME/KEY: Protein                                                     
(B) LOCATION: 1..101                                                      
(D) OTHER INFORMATION: /note= "CBMP-2B(FX)"                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:                                  
CysArgArgHisSerLeuTyrValAspPheSerAspValGlyTrpAsn                          
151015                                                                    
AspTrpIleValAlaProProGlyTyrGlnAlaPheTyrCysHisGly                          
202530                                                                    
AspCysProPheProLeuAlaAspHisLeuAsnSerThrAsnHisAla                          
354045                                                                    
IleValGlnThrLeuValAsnSerValAsnSerSerIleProLysAla                          
505560                                                                    
CysCysValProThrGluLeuSerAlaIleSerMetLeuTyrLeuAsp                          
65707580                                                                  
GluTyrAspLysValValLeuLysAsnTyrGlnGluMetValValGlu                          
859095                                                                    
GlyCysGlyCysArg                                                           
100                                                                       
(2) INFORMATION FOR SEQ ID NO:11:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 102 amino acids                                               
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(ix) FEATURE:                                                             
(A) NAME/KEY: Protein                                                     
(B) LOCATION: 1..102                                                      
(D) OTHER INFORMATION: /note= "DPP(FX)"                                   
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:                                  
CysArgArgHisSerLeuTyrValAspPheSerAspValGlyTrpAsp                          
151015                                                                    
AspTrpIleValAlaProLeuGlyTyrAspAlaTyrTyrCysHisGly                          
202530                                                                    
LysCysProPheProLeuAlaAspHisPheAsnSerThrAsnHisAla                          
354045                                                                    
ValValGlnThrLeuValAsnAsnAsnAsnProGlyLysValProLys                          
505560                                                                    
AlaCysCysValProThrGlnLeuAspSerValAlaMetLeuTyrLeu                          
65707580                                                                  
AsnAspGlnSerThrValValLeuLysAsnTyrGlnGluMetThrVal                          
859095                                                                    
ValGlyCysGlyCysArg                                                        
100                                                                       
(2) INFORMATION FOR SEQ ID NO:12:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 102 amino acids                                               
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(ix) FEATURE:                                                             
(A) NAME/KEY: Protein                                                     
(B) LOCATION: 1..102                                                      
(D) OTHER INFORMATION: /note= "VGL(FX)"                                   
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:                                  
CysLysLysArgHisLeuTyrValGluPheLysAspValGlyTrpGln                          
151015                                                                    
AsnTrpValIleAlaProGlnGlyTyrMetAlaAsnTyrCysTyrGly                          
202530                                                                    
GluCysProTyrProLeuThrGluIleLeuAsnGlySerAsnHisAla                          
354045                                                                    
IleLeuGlnThrLeuValHisSerIleGluProGluAspIleProLeu                          
505560                                                                    
ProCysCysValProThrLysMetSerProIleSerMetLeuPheTyr                          
65707580                                                                  
AspAsnAsnAspAsnValValLeuArgHisTyrGluAsnMetAlaVal                          
859095                                                                    
AspGluCysGlyCysArg                                                        
100                                                                       
(2) INFORMATION FOR SEQ ID NO:13:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 102 amino acids                                               
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(ix) FEATURE:                                                             
(A) NAME/KEY: Protein                                                     
(B) LOCATION: 1..102                                                      
(D) OTHER INFORMATION: /note= "VGR-1(FX)"                                 
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:                                  
CysLysLysHisGluLeuTyrValSerPheGlnAspValGlyTrpGln                          
151015                                                                    
AspTrpIleIleAlaProLysGlyTyrAlaAlaAsnTyrCysAspGly                          
202530                                                                    
GluCysSerPheProLeuAsnAlaHisMetAsnAlaThrAsnHisAla                          
354045                                                                    
IleValGlnThrLeuValHisValMetAsnProGluTyrValProLys                          
505560                                                                    
ProCysCysAlaProThrLysValAsnAlaIleSerValLeuTyrPhe                          
65707580                                                                  
AspAspAsnSerAsnValIleLeuLysLysTyrArgAsnMetValVal                          
859095                                                                    
ArgAlaCysGlyCysHis                                                        
100                                                                       
(2) INFORMATION FOR SEQ ID NO:14:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 106 amino acids                                               
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(ix) FEATURE:                                                             
(A) NAME/KEY: Protein                                                     
(B) LOCATION: 1..106                                                      
(D) OTHER INFORMATION: /note= "GDF-1 (FX)"                                
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:                                  
CysArgAlaArgArgLeuTyrValSerPheArgGluValGlyTrpHis                          
151015                                                                    
ArgTrpValIleAlaProArgGlyPheLeuAlaAsnTyrCysGlnGly                          
202530                                                                    
GlnCysAlaLeuProValAlaLeuSerGlySerGlyGlyProProAla                          
354045                                                                    
LeuAsnHisAlaValLeuArgAlaLeuMetHisAlaAlaAlaProGly                          
505560                                                                    
AlaAlaAspLeuProCysCysValProAlaArgLeuSerProIleSer                          
65707580                                                                  
ValLeuPhePheAspAsnSerAspAsnValValLeuArgGlnTyrGlu                          
859095                                                                    
AspMetValValAspGluCysGlyCysArg                                            
100105                                                                    
(2) INFORMATION FOR SEQ ID NO:15:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 5 amino acids                                                 
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:                                  
CysXaaXaaXaaXaa                                                           
15                                                                        
(2) INFORMATION FOR SEQ ID NO:16:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 1822 base pairs                                               
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: cDNA                                                  
(ix) FEATURE:                                                             
(A) NAME/KEY: CDS                                                         
(B) LOCATION: 49..1341                                                    
(D) OTHER INFORMATION: /product= "HOP-1"                                  
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:                                  
GGTGCGGGCCCGGAGCCCGGAGCCCGGGTAGCGCGTAGAGCCGGCGCGATGCACGTG57               
MetHisVal                                                                 
CGCTCACTGCGAGCTGCGGCGCCGCACAGCTTCGTGGCGCTCTGGGCA105                       
ArgSerLeuArgAlaAlaAlaProHisSerPheValAlaLeuTrpAla                          
51015                                                                     
CCCCTGTTCCTGCTGCGCTCCGCCCTGGCCGACTTCAGCCTGGACAAC153                       
ProLeuPheLeuLeuArgSerAlaLeuAlaAspPheSerLeuAspAsn                          
20253035                                                                  
GAGGTGCACTCGAGCTTCATCCACCGGCGCCTCCGCAGCCAGGAGCGG201                       
GluValHisSerSerPheIleHisArgArgLeuArgSerGlnGluArg                          
404550                                                                    
CGGGAGATGCAGCGCGAGATCCTCTCCATTTTGGGCTTGCCCCACCGC249                       
ArgGluMetGlnArgGluIleLeuSerIleLeuGlyLeuProHisArg                          
556065                                                                    
CCGCGCCCGCACCTCCAGGGCAAGCACAACTCGGCACCCATGTTCATG297                       
ProArgProHisLeuGlnGlyLysHisAsnSerAlaProMetPheMet                          
707580                                                                    
CTGGACCTGTACAACGCCATGGCGGTGGAGGAGGGCGGCGGGCCCGGC345                       
LeuAspLeuTyrAsnAlaMetAlaValGluGluGlyGlyGlyProGly                          
859095                                                                    
GGCCAGGGCTTCTCCTACCCCTACAAGGCCGTCTTCAGTACCCAGGGC393                       
GlyGlnGlyPheSerTyrProTyrLysAlaValPheSerThrGlnGly                          
100105110115                                                              
CCCCCTCTGGCCAGCCTGCAAGATAGCCATTTCCTCACCGACGCCGAC441                       
ProProLeuAlaSerLeuGlnAspSerHisPheLeuThrAspAlaAsp                          
120125130                                                                 
ATGGTCATGAGCTTCGTCAACCTCGTGGAACATGACAAGGAATTCTTC489                       
MetValMetSerPheValAsnLeuValGluHisAspLysGluPhePhe                          
135140145                                                                 
CACCCACGCTACCACCATCGAGAGTTCCGGTTTGATCTTTCCAAGATC537                       
HisProArgTyrHisHisArgGluPheArgPheAspLeuSerLysIle                          
150155160                                                                 
CCAGAAGGGGAAGCTGTCACGGCAGCCGAATTCCGGATCTACAAGGAC585                       
ProGluGlyGluAlaValThrAlaAlaGluPheArgIleTyrLysAsp                          
165170175                                                                 
TACATCCGGGAACGCTTCGACAATGAGACGTTCCGGATCAGCGTTTAT633                       
TyrIleArgGluArgPheAspAsnGluThrPheArgIleSerValTyr                          
180185190195                                                              
CAGGTGCTCCAGGAGCACTTGGGCAGGGAATCGGATCTCTTCCTGCTC681                       
GlnValLeuGlnGluHisLeuGlyArgGluSerAspLeuPheLeuLeu                          
200205210                                                                 
GACAGCCGTACCCTCTGGGCCTCGGAGGAGGGCTGGCTGGTGTTTGAC729                       
AspSerArgThrLeuTrpAlaSerGluGluGlyTrpLeuValPheAsp                          
215220225                                                                 
ATCACAGCCACCAGCAACCACTGGGTGGTCAATCCGCGGCACAACCTG777                       
IleThrAlaThrSerAsnHisTrpValValAsnProArgHisAsnLeu                          
230235240                                                                 
GGCCTGCAGCTCTCGGTGGAGACGCTGGATGGGCAGAGCATCAACCCC825                       
GlyLeuGlnLeuSerValGluThrLeuAspGlyGlnSerIleAsnPro                          
245250255                                                                 
AAGTTGGCGGGCCTGATTGGGCGGCACGGGCCCCAGAACAAGCAGCCC873                       
LysLeuAlaGlyLeuIleGlyArgHisGlyProGlnAsnLysGlnPro                          
260265270275                                                              
TTCATGGTGGCTTTCTTCAAGGCCACGGAGGTCCACTTCCGCAGCATC921                       
PheMetValAlaPhePheLysAlaThrGluValHisPheArgSerIle                          
280285290                                                                 
CGGTCCACGGGGAGCAAACAGCGCAGCCAGAACCGCTCCAAGACGCCC969                       
ArgSerThrGlySerLysGlnArgSerGlnAsnArgSerLysThrPro                          
295300305                                                                 
AAGAACCAGGAAGCCCTGCGGATGGCCAACGTGGCAGAGAACAGCAGC1017                      
LysAsnGlnGluAlaLeuArgMetAlaAsnValAlaGluAsnSerSer                          
310315320                                                                 
AGCGACCAGAGGCAGGCCTGTAAGAAGCACGAGCTGTATGTCAGCTTC1065                      
SerAspGlnArgGlnAlaCysLysLysHisGluLeuTyrValSerPhe                          
325330335                                                                 
CGAGACCTGGGCTGGCAGGACTGGATCATCGCGCCTGAAGGCTACGCC1113                      
ArgAspLeuGlyTrpGlnAspTrpIleIleAlaProGluGlyTyrAla                          
340345350355                                                              
GCCTACTACTGTGAGGGGGAGTGTGCCTTCCCTCTGAACTCCTACATG1161                      
AlaTyrTyrCysGluGlyGluCysAlaPheProLeuAsnSerTyrMet                          
360365370                                                                 
AACGCCACCAACCACGCCATCGTGCAGACGCTGGTCCACTTCATCAAC1209                      
AsnAlaThrAsnHisAlaIleValGlnThrLeuValHisPheIleAsn                          
375380385                                                                 
CCGGAAACGGTGCCCAAGCCCTGCTGTGCGCCCACGCAGCTCAATGCC1257                      
ProGluThrValProLysProCysCysAlaProThrGlnLeuAsnAla                          
390395400                                                                 
ATCTCCGTCCTCTACTTCGATGACAGCTCCAACGTCATCCTGAAGAAA1305                      
IleSerValLeuTyrPheAspAspSerSerAsnValIleLeuLysLys                          
405410415                                                                 
TACAGAAACATGGTGGTCCGGGCCTGTGGCTGCCACTAGCTCCTCC1351                        
TyrArgAsnMetValValArgAlaCysGlyCysHis                                      
420425430                                                                 
GAGAATTCAGACCCTTTGGGGCCAAGTTTTTCTGGATCCTCCATTGCTCGCCTTGGCCAG1411          
GAACCAGCAGACCAACTGCCTTTTGTGAGACCTTCCCCTCCCTATCCCCAACTTTAAAGG1471          
TGTGAGAGTATTAGGAAACATGAGCAGCATATGGCTTTTGATCAGTTTTTCAGTGGCAGC1531          
ATCCAATGAACAAGATCCTACAAGCTGTGCAGGCAAAACCTAGCAGGAAAAAAAAACAAC1591          
GCATAAAGAAAAATGGCCGGGCCAGGTCATTGGCTGGGAAGTCTCAGCCATGCACGGACT1651          
CGTTTCCAGAGGTAATTATGAGCGCCTACCAGCCAGGCCACCCAGCCGTGGGAGGAAGGG1711          
GGCGTGGCAAGGGGTGGGCACATTGGTGTCTGTGCGAAAGGAAAATTGACCCGGAAGTTC1771          
CTGTAATAAATGTCACAATAAAACGAATGAATGAAAAAAAAAAAAAAAAAA1822                   
(2) INFORMATION FOR SEQ ID NO:17:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 431 amino acids                                               
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:                                  
MetHisValArgSerLeuArgAlaAlaAlaProHisSerPheValAla                          
151015                                                                    
LeuTrpAlaProLeuPheLeuLeuArgSerAlaLeuAlaAspPheSer                          
202530                                                                    
LeuAspAsnGluValHisSerSerPheIleHisArgArgLeuArgSer                          
354045                                                                    
GlnGluArgArgGluMetGlnArgGluIleLeuSerIleLeuGlyLeu                          
505560                                                                    
ProHisArgProArgProHisLeuGlnGlyLysHisAsnSerAlaPro                          
65707580                                                                  
MetPheMetLeuAspLeuTyrAsnAlaMetAlaValGluGluGlyGly                          
859095                                                                    
GlyProGlyGlyGlnGlyPheSerTyrProTyrLysAlaValPheSer                          
100105110                                                                 
ThrGlnGlyProProLeuAlaSerLeuGlnAspSerHisPheLeuThr                          
115120125                                                                 
AspAlaAspMetValMetSerPheValAsnLeuValGluHisAspLys                          
130135140                                                                 
GluPhePheHisProArgTyrHisHisArgGluPheArgPheAspLeu                          
145150155160                                                              
SerLysIleProGluGlyGluAlaValThrAlaAlaGluPheArgIle                          
165170175                                                                 
TyrLysAspTyrIleArgGluArgPheAspAsnGluThrPheArgIle                          
180185190                                                                 
SerValTyrGlnValLeuGlnGluHisLeuGlyArgGluSerAspLeu                          
195200205                                                                 
PheLeuLeuAspSerArgThrLeuTrpAlaSerGluGluGlyTrpLeu                          
210215220                                                                 
ValPheAspIleThrAlaThrSerAsnHisTrpValValAsnProArg                          
225230235240                                                              
HisAsnLeuGlyLeuGlnLeuSerValGluThrLeuAspGlyGlnSer                          
245250255                                                                 
IleAsnProLysLeuAlaGlyLeuIleGlyArgHisGlyProGlnAsn                          
260265270                                                                 
LysGlnProPheMetValAlaPhePheLysAlaThrGluValHisPhe                          
275280285                                                                 
ArgSerIleArgSerThrGlySerLysGlnArgSerGlnAsnArgSer                          
290295300                                                                 
LysThrProLysAsnGlnGluAlaLeuArgMetAlaAsnValAlaGlu                          
305310315320                                                              
AsnSerSerSerAspGlnArgGlnAlaCysLysLysHisGluLeuTyr                          
325330335                                                                 
ValSerPheArgAspLeuGlyTrpGlnAspTrpIleIleAlaProGlu                          
340345350                                                                 
GlyTyrAlaAlaTyrTyrCysGluGlyGluCysAlaPheProLeuAsn                          
355360365                                                                 
SerTyrMetAsnAlaThrAsnHisAlaIleValGlnThrLeuValHis                          
370375380                                                                 
PheIleAsnProGluThrValProLysProCysCysAlaProThrGln                          
385390395400                                                              
LeuAsnAlaIleSerValLeuTyrPheAspAspSerSerAsnValIle                          
405410415                                                                 
LeuLysLysTyrArgAsnMetValValArgAlaCysGlyCysHis                             
420425430                                                                 
(2) INFORMATION FOR SEQ ID NO:18:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 1873 base pairs                                               
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: cDNA                                                  
(ix) FEATURE:                                                             
(A) NAME/KEY: CDS                                                         
(B) LOCATION: 104..1393                                                   
(D) OTHER INFORMATION: /product= "MOP1 (CDNA)"                            
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:                                  
CTGCAGCAAGTGACCTCGGGTCGTGGACCGCTGCCCTGCCCCCTCCGCTGCCACCTGGGG60            
CGGCGCGGGCCCGGTGCCCCGGATCGCGCGTAGAGCCGGCGCGATGCACGTGCGC115                
MetHisValArg                                                              
1                                                                         
TCGCTGCGCGCTGCGGCGCCACACAGCTTCGTGGCGCTCTGGGCGCCT163                       
SerLeuArgAlaAlaAlaProHisSerPheValAlaLeuTrpAlaPro                          
5101520                                                                   
CTGTTCTTGCTGCGCTCCGCCCTGGCCGATTTCAGCCTGGACAACGAG211                       
LeuPheLeuLeuArgSerAlaLeuAlaAspPheSerLeuAspAsnGlu                          
253035                                                                    
GTGCACTCCAGCTTCATCCACCGGCGCCTCCGCAGCCAGGAGCGGCGG259                       
ValHisSerSerPheIleHisArgArgLeuArgSerGlnGluArgArg                          
404550                                                                    
GAGATGCAGCGGGAGATCCTGTCCATCTTAGGGTTGCCCCATCGCCCG307                       
GluMetGlnArgGluIleLeuSerIleLeuGlyLeuProHisArgPro                          
556065                                                                    
CGCCCGCACCTCCAGGGAAAGCATAATTCGGCGCCCATGTTCATGTTG355                       
ArgProHisLeuGlnGlyLysHisAsnSerAlaProMetPheMetLeu                          
707580                                                                    
GACCTGTACAACGCCATGGCGGTGGAGGAGAGCGGGCCGGACGGACAG403                       
AspLeuTyrAsnAlaMetAlaValGluGluSerGlyProAspGlyGln                          
859095100                                                                 
GGCTTCTCCTACCCCTACAAGGCCGTCTTCAGTACCCAGGGCCCCCCT451                       
GlyPheSerTyrProTyrLysAlaValPheSerThrGlnGlyProPro                          
105110115                                                                 
TTAGCCAGCCTGCAGGACAGCCATTTCCTCACTGACGCCGACATGGTC499                       
LeuAlaSerLeuGlnAspSerHisPheLeuThrAspAlaAspMetVal                          
120125130                                                                 
ATGAGCTTCGTCAACCTAGTGGAACATGACAAAGAATTCTTCCACCCT547                       
MetSerPheValAsnLeuValGluHisAspLysGluPhePheHisPro                          
135140145                                                                 
CGATACCACCATCGGGAGTTCCGGTTTGATCTTTCCAAGATCCCCGAG595                       
ArgTyrHisHisArgGluPheArgPheAspLeuSerLysIleProGlu                          
150155160                                                                 
GGCGAACGGGTGACCGCAGCCGAATTCAGGATCTATAAGGACTACATC643                       
GlyGluArgValThrAlaAlaGluPheArgIleTyrLysAspTyrIle                          
165170175180                                                              
CGGGAGCGATTTGACAACGAGACCTTCCAGATCACAGTCTATCAGGTG691                       
ArgGluArgPheAspAsnGluThrPheGlnIleThrValTyrGlnVal                          
185190195                                                                 
CTCCAGGAGCACTCAGGCAGGGAGTCGGACCTCTTCTTGCTGGACAGC739                       
LeuGlnGluHisSerGlyArgGluSerAspLeuPheLeuLeuAspSer                          
200205210                                                                 
CGCACCATCTGGGCTTCTGAGGAGGGCTGGTTGGTGTTTGATATCACA787                       
ArgThrIleTrpAlaSerGluGluGlyTrpLeuValPheAspIleThr                          
215220225                                                                 
GCCACCAGCAACCACTGGGTGGTCAACCCTCGGCACAACCTGGGCTTA835                       
AlaThrSerAsnHisTrpValValAsnProArgHisAsnLeuGlyLeu                          
230235240                                                                 
CAGCTCTCTGTGGAGACCCTGGATGGGCAGAGCATCAACCCCAAGTTG883                       
GlnLeuSerValGluThrLeuAspGlyGlnSerIleAsnProLysLeu                          
245250255260                                                              
GCAGGCCTGATTGGACGGCATGGACCCCAGAACAAGCAACCCTTCATG931                       
AlaGlyLeuIleGlyArgHisGlyProGlnAsnLysGlnProPheMet                          
265270275                                                                 
GTGGCCTTCTTCAAGGCCACGGAAGTCCATCTCCGTAGTATCCGGTCC979                       
ValAlaPhePheLysAlaThrGluValHisLeuArgSerIleArgSer                          
280285290                                                                 
ACGGGGGGCAAGCAGCGCAGCCAGAATCGCTCCAAGACGCCAAAGAAC1027                      
ThrGlyGlyLysGlnArgSerGlnAsnArgSerLysThrProLysAsn                          
295300305                                                                 
CAAGAGGCCCTGAGGATGGCCAGTGTGGCAGAAAACAGCAGCAGTGAC1075                      
GlnGluAlaLeuArgMetAlaSerValAlaGluAsnSerSerSerAsp                          
310315320                                                                 
CAGAGGCAGGCCTGCAAGAAACATGAGCTGTACGTCAGCTTCCGAGAC1123                      
GlnArgGlnAlaCysLysLysHisGluLeuTyrValSerPheArgAsp                          
325330335340                                                              
CTTGGCTGGCAGGACTGGATCATTGCACCTGAAGGCTATGCTGCCTAC1171                      
LeuGlyTrpGlnAspTrpIleIleAlaProGluGlyTyrAlaAlaTyr                          
345350355                                                                 
TACTGTGAGGGAGAGTGCGCCTTCCCTCTGAACTCCTACATGAACGCC1219                      
TyrCysGluGlyGluCysAlaPheProLeuAsnSerTyrMetAsnAla                          
360365370                                                                 
ACCAACCACGCCATCGTCCAGACACTGGTTCACTTCATCAACCCAGAC1267                      
ThrAsnHisAlaIleValGlnThrLeuValHisPheIleAsnProAsp                          
375380385                                                                 
ACAGTACCCAAGCCCTGCTGTGCGCCCACCCAGCTCAACGCCATCTCT1315                      
ThrValProLysProCysCysAlaProThrGlnLeuAsnAlaIleSer                          
390395400                                                                 
GTCCTCTACTTCGACGACAGCTCTAATGTCATCCTGAAGAAGTACAGA1363                      
ValLeuTyrPheAspAspSerSerAsnValIleLeuLysLysTyrArg                          
405410415420                                                              
AACATGGTGGTCCGGGCCTGTGGCTGCCACTAGCTCTTCCTGAGACCCTG1413                    
AsnMetValValArgAlaCysGlyCysHis                                            
425430                                                                    
ACCTTTGCGGGGCCACACCTTTCCAAATCTTCGATGTCTCACCATCTAAGTCTCTCACTG1473          
CCCACCTTGGCGAGGAGAACAGACCAACCTCTCCTGAGCCTTCCCTCACCTCCCAACCGG1533          
AAGCATGTAAGGGTTCCAGAAACCTGAGCGTGCAGCAGCTGATGAGCGCCCTTTCCTTCT1593          
GGCACGTGACGGACAAGATCCTACCAGCTACCACAGCAAACGCCTAAGAGCAGGAAAAAT1653          
GTCTGCCAGGAAAGTGTCCAGTGTCCACATGGCCCCTGGCGCTCTGAGTCTTTGAGGAGT1713          
AATCGCAAGCCTCGTTCAGCTGCAGCAGAAGGAAGGGCTTAGCCAGGGTGGGCGCTGGCG1773          
TCTGTGTTGAAGGGAAACCAAGCAGAAGCCACTGTAATGATATGTCACAATAAAACCCAT1833          
GAATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAATTC1873                              
(2) INFORMATION FOR SEQ ID NO:19:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 430 amino acids                                               
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:                                  
MetHisValArgSerLeuArgAlaAlaAlaProHisSerPheValAla                          
151015                                                                    
LeuTrpAlaProLeuPheLeuLeuArgSerAlaLeuAlaAspPheSer                          
202530                                                                    
LeuAspAsnGluValHisSerSerPheIleHisArgArgLeuArgSer                          
354045                                                                    
GlnGluArgArgGluMetGlnArgGluIleLeuSerIleLeuGlyLeu                          
505560                                                                    
ProHisArgProArgProHisLeuGlnGlyLysHisAsnSerAlaPro                          
65707580                                                                  
MetPheMetLeuAspLeuTyrAsnAlaMetAlaValGluGluSerGly                          
859095                                                                    
ProAspGlyGlnGlyPheSerTyrProTyrLysAlaValPheSerThr                          
100105110                                                                 
GlnGlyProProLeuAlaSerLeuGlnAspSerHisPheLeuThrAsp                          
115120125                                                                 
AlaAspMetValMetSerPheValAsnLeuValGluHisAspLysGlu                          
130135140                                                                 
PhePheHisProArgTyrHisHisArgGluPheArgPheAspLeuSer                          
145150155160                                                              
LysIleProGluGlyGluArgValThrAlaAlaGluPheArgIleTyr                          
165170175                                                                 
LysAspTyrIleArgGluArgPheAspAsnGluThrPheGlnIleThr                          
180185190                                                                 
ValTyrGlnValLeuGlnGluHisSerGlyArgGluSerAspLeuPhe                          
195200205                                                                 
LeuLeuAspSerArgThrIleTrpAlaSerGluGluGlyTrpLeuVal                          
210215220                                                                 
PheAspIleThrAlaThrSerAsnHisTrpValValAsnProArgHis                          
225230235240                                                              
AsnLeuGlyLeuGlnLeuSerValGluThrLeuAspGlyGlnSerIle                          
245250255                                                                 
AsnProLysLeuAlaGlyLeuIleGlyArgHisGlyProGlnAsnLys                          
260265270                                                                 
GlnProPheMetValAlaPhePheLysAlaThrGluValHisLeuArg                          
275280285                                                                 
SerIleArgSerThrGlyGlyLysGlnArgSerGlnAsnArgSerLys                          
290295300                                                                 
ThrProLysAsnGlnGluAlaLeuArgMetAlaSerValAlaGluAsn                          
305310315320                                                              
SerSerSerAspGlnArgGlnAlaCysLysLysHisGluLeuTyrVal                          
325330335                                                                 
SerPheArgAspLeuGlyTrpGlnAspTrpIleIleAlaProGluGly                          
340345350                                                                 
TyrAlaAlaTyrTyrCysGluGlyGluCysAlaPheProLeuAsnSer                          
355360365                                                                 
TyrMetAsnAlaThrAsnHisAlaIleValGlnThrLeuValHisPhe                          
370375380                                                                 
IleAsnProAspThrValProLysProCysCysAlaProThrGlnLeu                          
385390395400                                                              
AsnAlaIleSerValLeuTyrPheAspAspSerSerAsnValIleLeu                          
405410415                                                                 
LysLysTyrArgAsnMetValValArgAlaCysGlyCysHis                                
420425430                                                                 
(2) INFORMATION FOR SEQ ID NO:20:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 1723 base pairs                                               
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: cDNA                                                  
(ix) FEATURE:                                                             
(A) NAME/KEY: CDS                                                         
(B) LOCATION: 490..1695                                                   
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:                                  
GGCGCCGGCAGAGCAGGAGTGGCTGGAGGAGCTGTGGTTGGAGCAGGAGGTGGCACGGCA60            
GGGCTGGAGGGCTCCCTATGAGTGGCGGAGACGGCCCAGGAGGCGCTGGAGCAACAGCTC120           
CCACACCGCACCAAGCGGTGGCTGCAGGAGCTCGCCCATCGCCCCTGCGCTGCTCGGACC180           
GCGGCCACAGCCGGACTGGCGGGTACGGCGGCGACAGAGGCATTGGCCGAGAGTCCCAGT240           
CCGCAGAGTAGCCCCGGCCTCGAGGCGGTGGCGTCCCGGTCCTCTCCGTCCAGGAGCCAG300           
GACAGGTGTCGCGCGGCGGGGCTCCAGGGACCGCGCCTGAGGCCGGCTGCCCGCCCGTCC360           
CGCCCCGCCCCGCCGCCCGCCGCCCGCCGAGCCCAGCCTCCTTGCCGTCGGGGCGTCCCC420           
AGGCCCTGGGTCGGCCGCGGAGCCGATGCGCGCCCGCTGAGCGCCCCAGCTGAGCGCCCC480           
CGGCCTGCCATGACCGCGCTCCCCGGCCCGCTCTGGCTCCTGGGCCTG528                       
MetThrAlaLeuProGlyProLeuTrpLeuLeuGlyLeu                                   
1510                                                                      
GCGCTATGCGCGCTGGGCGGGGGCGGCCCCGGCCTGCGACCCCCGCCC576                       
AlaLeuCysAlaLeuGlyGlyGlyGlyProGlyLeuArgProProPro                          
152025                                                                    
GGCTGTCCCCAGCGACGTCTGGGCGCGCGCGAGCGCCGGGACGTGCAG624                       
GlyCysProGlnArgArgLeuGlyAlaArgGluArgArgAspValGln                          
30354045                                                                  
CGCGAGATCCTGGCGGTGCTCGGGCTGCCTGGGCGGCCCCGGCCCCGC672                       
ArgGluIleLeuAlaValLeuGlyLeuProGlyArgProArgProArg                          
505560                                                                    
GCGCCACCCGCCGCCTCCCGGCTGCCCGCGTCCGCGCCGCTCTTCATG720                       
AlaProProAlaAlaSerArgLeuProAlaSerAlaProLeuPheMet                          
657075                                                                    
CTGGACCTGTACCACGCCATGGCCGGCGACGACGACGAGGACGGCGCG768                       
LeuAspLeuTyrHisAlaMetAlaGlyAspAspAspGluAspGlyAla                          
808590                                                                    
CCCGCGGAGCGGCGCCTGGGCCGCGCCGACCTGGTCATGAGCTTCGTT816                       
ProAlaGluArgArgLeuGlyArgAlaAspLeuValMetSerPheVal                          
95100105                                                                  
AACATGGTGGAGCGAGACCGTGCCCTGGGCCACCAGGAGCCCCATTGG864                       
AsnMetValGluArgAspArgAlaLeuGlyHisGlnGluProHisTrp                          
110115120125                                                              
AAGGAGTTCCGCTTTGACCTGACCCAGATCCCGGCTGGGGAGGCGGTC912                       
LysGluPheArgPheAspLeuThrGlnIleProAlaGlyGluAlaVal                          
130135140                                                                 
ACAGCTGCGGAGTTCCGGATTTACAAGGTGCCCAGCATCCACCTGCTC960                       
ThrAlaAlaGluPheArgIleTyrLysValProSerIleHisLeuLeu                          
145150155                                                                 
AACAGGACCCTCCACGTCAGCATGTTCCAGGTGGTCCAGGAGCAGTCC1008                      
AsnArgThrLeuHisValSerMetPheGlnValValGlnGluGlnSer                          
160165170                                                                 
AACAGGGAGTCTGACTTGTTCTTTTTGGATCTTCAGACGCTCCGAGCT1056                      
AsnArgGluSerAspLeuPhePheLeuAspLeuGlnThrLeuArgAla                          
175180185                                                                 
GGAGACGAGGGCTGGCTGGTGCTGGATGTCACAGCAGCCAGTGACTGC1104                      
GlyAspGluGlyTrpLeuValLeuAspValThrAlaAlaSerAspCys                          
190195200205                                                              
TGGTTGCTGAAGCGTCACAAGGACCTGGGACTCCGCCTCTATGTGGAG1152                      
TrpLeuLeuLysArgHisLysAspLeuGlyLeuArgLeuTyrValGlu                          
210215220                                                                 
ACTGAGGACGGGCACAGCGTGGATCCTGGCCTGGCCGGCCTGCTGGGT1200                      
ThrGluAspGlyHisSerValAspProGlyLeuAlaGlyLeuLeuGly                          
225230235                                                                 
CAACGGGCCCCACGCTCCCAACAGCCTTTCGTGGTCACTTTCTTCAGG1248                      
GlnArgAlaProArgSerGlnGlnProPheValValThrPhePheArg                          
240245250                                                                 
GCCAGTCCGAGTCCCATCCGCACCCCTCGGGCAGTGAGGCCACTGAGG1296                      
AlaSerProSerProIleArgThrProArgAlaValArgProLeuArg                          
255260265                                                                 
AGGAGGCAGCCGAAGAAAAGCAACGAGCTGCCGCAGGCCAACCGACTC1344                      
ArgArgGlnProLysLysSerAsnGluLeuProGlnAlaAsnArgLeu                          
270275280285                                                              
CCAGGGATCTTTGATGACGTCCACGGCTCCCACGGCCGGCAGGTCTGC1392                      
ProGlyIlePheAspAspValHisGlySerHisGlyArgGlnValCys                          
290295300                                                                 
CGTCGGCACGAGCTCTACGTCAGCTTCCAGGACCTCGGCTGGCTGGAC1440                      
ArgArgHisGluLeuTyrValSerPheGlnAspLeuGlyTrpLeuAsp                          
305310315                                                                 
TGGGTCATCGCTCCCCAAGGCTACTCGGCCTATTACTGTGAGGGGGAG1488                      
TrpValIleAlaProGlnGlyTyrSerAlaTyrTyrCysGluGlyGlu                          
320325330                                                                 
TGCTCCTTCCCACTGGACTCCTGCATGAATGCCACCAACCACGCCATC1536                      
CysSerPheProLeuAspSerCysMetAsnAlaThrAsnHisAlaIle                          
335340345                                                                 
CTGCAGTCCCTGGTGCACCTGATGAAGCCAAACGCAGTCCCCAAGGCG1584                      
LeuGlnSerLeuValHisLeuMetLysProAsnAlaValProLysAla                          
350355360365                                                              
TGCTGTGCACCCACCAAGCTGAGCGCCACCTCTGTGCTCTACTATGAC1632                      
CysCysAlaProThrLysLeuSerAlaThrSerValLeuTyrTyrAsp                          
370375380                                                                 
AGCAGCAACAACGTCATCCTGCGCAAACACCGCAACATGGTGGTCAAG1680                      
SerSerAsnAsnValIleLeuArgLysHisArgAsnMetValValLys                          
385390395                                                                 
GCCTGCGGCTGCCACTGAGTCAGCCCGCCCAGCCCTACTGCAG1723                           
AlaCysGlyCysHis                                                           
400                                                                       
(2) INFORMATION FOR SEQ ID NO:21:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 402 amino acids                                               
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:                                  
MetThrAlaLeuProGlyProLeuTrpLeuLeuGlyLeuAlaLeuCys                          
151015                                                                    
AlaLeuGlyGlyGlyGlyProGlyLeuArgProProProGlyCysPro                          
202530                                                                    
GlnArgArgLeuGlyAlaArgGluArgArgAspValGlnArgGluIle                          
354045                                                                    
LeuAlaValLeuGlyLeuProGlyArgProArgProArgAlaProPro                          
505560                                                                    
AlaAlaSerArgLeuProAlaSerAlaProLeuPheMetLeuAspLeu                          
65707580                                                                  
TyrHisAlaMetAlaGlyAspAspAspGluAspGlyAlaProAlaGlu                          
859095                                                                    
ArgArgLeuGlyArgAlaAspLeuValMetSerPheValAsnMetVal                          
100105110                                                                 
GluArgAspArgAlaLeuGlyHisGlnGluProHisTrpLysGluPhe                          
115120125                                                                 
ArgPheAspLeuThrGlnIleProAlaGlyGluAlaValThrAlaAla                          
130135140                                                                 
GluPheArgIleTyrLysValProSerIleHisLeuLeuAsnArgThr                          
145150155160                                                              
LeuHisValSerMetPheGlnValValGlnGluGlnSerAsnArgGlu                          
165170175                                                                 
SerAspLeuPhePheLeuAspLeuGlnThrLeuArgAlaGlyAspGlu                          
180185190                                                                 
GlyTrpLeuValLeuAspValThrAlaAlaSerAspCysTrpLeuLeu                          
195200205                                                                 
LysArgHisLysAspLeuGlyLeuArgLeuTyrValGluThrGluAsp                          
210215220                                                                 
GlyHisSerValAspProGlyLeuAlaGlyLeuLeuGlyGlnArgAla                          
225230235240                                                              
ProArgSerGlnGlnProPheValValThrPhePheArgAlaSerPro                          
245250255                                                                 
SerProIleArgThrProArgAlaValArgProLeuArgArgArgGln                          
260265270                                                                 
ProLysLysSerAsnGluLeuProGlnAlaAsnArgLeuProGlyIle                          
275280285                                                                 
PheAspAspValHisGlySerHisGlyArgGlnValCysArgArgHis                          
290295300                                                                 
GluLeuTyrValSerPheGlnAspLeuGlyTrpLeuAspTrpValIle                          
305310315320                                                              
AlaProGlnGlyTyrSerAlaTyrTyrCysGluGlyGluCysSerPhe                          
325330335                                                                 
ProLeuAspSerCysMetAsnAlaThrAsnHisAlaIleLeuGlnSer                          
340345350                                                                 
LeuValHisLeuMetLysProAsnAlaValProLysAlaCysCysAla                          
355360365                                                                 
ProThrLysLeuSerAlaThrSerValLeuTyrTyrAspSerSerAsn                          
370375380                                                                 
AsnValIleLeuArgLysHisArgAsnMetValValLysAlaCysGly                          
385390395400                                                              
CysHis                                                                    
(2) INFORMATION FOR SEQ ID NO:22:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 1926 base pairs                                               
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: cDNA                                                  
(ix) FEATURE:                                                             
(A) NAME/KEY: CDS                                                         
(B) LOCATION: 93..1289                                                    
(D) OTHER INFORMATION: /product= "MOP2 CDNA"                              
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:                                  
GCCAGGCACAGGTGCGCCGTCTGGTCCTCCCCGTCTGGCGTCAGCCGAGCCCGACCAGCT60            
ACCAGTGGATGCGCGCCGGCTGAAAGTCCGAGATGGCTATGCGTCCCGGGCCA113                  
MetAlaMetArgProGlyPro                                                     
15                                                                        
CTCTGGCTATTGGGCCTTGCTCTGTGCGCGCTGGGAGGCGGCCACGGT161                       
LeuTrpLeuLeuGlyLeuAlaLeuCysAlaLeuGlyGlyGlyHisGly                          
101520                                                                    
CCGCGTCCCCCGCACACCTGTCCCCAGCGTCGCCTGGGAGCGCGCGAG209                       
ProArgProProHisThrCysProGlnArgArgLeuGlyAlaArgGlu                          
253035                                                                    
CGCCGCGACATGCAGCGTGAAATCCTGGCGGTGCTCGGGCTACCGGGA257                       
ArgArgAspMetGlnArgGluIleLeuAlaValLeuGlyLeuProGly                          
40455055                                                                  
CGGCCCCGACCCCGTGCACAACCCGCGGCTGCCCGGCAGCCAGCGTCC305                       
ArgProArgProArgAlaGlnProAlaAlaAlaArgGlnProAlaSer                          
606570                                                                    
GCGCCCCTCTTCATGTTGGACCTATACCACGCCATGACCGATGACGAC353                       
AlaProLeuPheMetLeuAspLeuTyrHisAlaMetThrAspAspAsp                          
758085                                                                    
GACGGCGGGCCACCACAGGCTCACTTAGGCCGTGCCGACCTGGTCATG401                       
AspGlyGlyProProGlnAlaHisLeuGlyArgAlaAspLeuValMet                          
9095100                                                                   
AGCTTCGTCAACATGGTGGAACGCGACCGTACCCTGGGCTACCAGGAG449                       
SerPheValAsnMetValGluArgAspArgThrLeuGlyTyrGlnGlu                          
105110115                                                                 
CCACACTGGAAGGAATTCCACTTTGACCTAACCCAGATCCCTGCTGGG497                       
ProHisTrpLysGluPheHisPheAspLeuThrGlnIleProAlaGly                          
120125130135                                                              
GAGGCTGTCACAGCTGCTGAGTTCCGGATCTACAAAGAACCCAGCACC545                       
GluAlaValThrAlaAlaGluPheArgIleTyrLysGluProSerThr                          
140145150                                                                 
CACCCGCTCAACACAACCCTCCACATCAGCATGTTCGAAGTGGTCCAA593                       
HisProLeuAsnThrThrLeuHisIleSerMetPheGluValValGln                          
155160165                                                                 
GAGCACTCCAACAGGGAGTCTGACTTGTTCTTTTTGGATCTTCAGACG641                       
GluHisSerAsnArgGluSerAspLeuPhePheLeuAspLeuGlnThr                          
170175180                                                                 
CTCCGATCTGGGGACGAGGGCTGGCTGGTGCTGGACATCACAGCAGCC689                       
LeuArgSerGlyAspGluGlyTrpLeuValLeuAspIleThrAlaAla                          
185190195                                                                 
AGTGACCGATGGCTGCTGAACCATCACAAGGACCTGGGACTCCGCCTC737                       
SerAspArgTrpLeuLeuAsnHisHisLysAspLeuGlyLeuArgLeu                          
200205210215                                                              
TATGTGGAAACCGCGGATGGGCACAGCATGGATCCTGGCCTGGCTGGT785                       
TyrValGluThrAlaAspGlyHisSerMetAspProGlyLeuAlaGly                          
220225230                                                                 
CTGCTTGGACGACAAGCACCACGCTCCAGACAGCCTTTCATGGTAACC833                       
LeuLeuGlyArgGlnAlaProArgSerArgGlnProPheMetValThr                          
235240245                                                                 
TTCTTCAGGGCCAGCCAGAGTCCTGTGCGGGCCCCTCGGGCAGCGAGA881                       
PhePheArgAlaSerGlnSerProValArgAlaProArgAlaAlaArg                          
250255260                                                                 
CCACTGAAGAGGAGGCAGCCAAAGAAAACGAACGAGCTTCCGCACCCC929                       
ProLeuLysArgArgGlnProLysLysThrAsnGluLeuProHisPro                          
265270275                                                                 
AACAAACTCCCAGGGATCTTTGATGATGGCCACGGTTCCCGCGGCAGA977                       
AsnLysLeuProGlyIlePheAspAspGlyHisGlySerArgGlyArg                          
280285290295                                                              
GAGGTTTGCCGCAGGCATGAGCTCTACGTCAGCTTCCGTGACCTTGGC1025                      
GluValCysArgArgHisGluLeuTyrValSerPheArgAspLeuGly                          
300305310                                                                 
TGGCTGGACTGGGTCATCGCCCCCCAGGGCTACTCTGCCTATTACTGT1073                      
TrpLeuAspTrpValIleAlaProGlnGlyTyrSerAlaTyrTyrCys                          
315320325                                                                 
GAGGGGGAGTGTGCTTTCCCACTGGACTCCTGTATGAACGCCACCAAC1121                      
GluGlyGluCysAlaPheProLeuAspSerCysMetAsnAlaThrAsn                          
330335340                                                                 
CATGCCATCTTGCAGTCTCTGGTGCACCTGATGAAGCCAGATGTTGTC1169                      
HisAlaIleLeuGlnSerLeuValHisLeuMetLysProAspValVal                          
345350355                                                                 
CCCAAGGCATGCTGTGCACCCACCAAACTGAGTGCCACCTCTGTGCTG1217                      
ProLysAlaCysCysAlaProThrLysLeuSerAlaThrSerValLeu                          
360365370375                                                              
TACTATGACAGCAGCAACAATGTCATCCTGCGTAAACACCGTAACATG1265                      
TyrTyrAspSerSerAsnAsnValIleLeuArgLysHisArgAsnMet                          
380385390                                                                 
GTGGTCAAGGCCTGTGGCTGCCACTGAGGCCCCGCCCAGCATCCTGCTTCTACT1319                
ValValLysAlaCysGlyCysHis                                                  
395                                                                       
ACCTTACCATCTGGCCGGGCCCCTCTCCAGAGGCAGAAACCCTTCTATGTTATCATAGCT1379          
CAGACAGGGGCAATGGGAGGCCCTTCACTTCCCCTGGCCACTTCCTGCTAAAATTCTGGT1439          
CTTTCCCAGTTCCTCTGTCCTTCATGGGGTTTCGGGGCTATCACCCCGCCCTCTCCATCC1499          
TCCTACCCCAAGCATAGACTGAATGCACACAGCATCCCAGAGCTATGCTAACTGAGAGGT1559          
CTGGGGTCAGCACTGAAGGCCCACATGAGGAAGACTGATCCTTGGCCATCCTCAGCCCAC1619          
AATGGCAAATTCTGGATGGTCTAAGAAGGCCGTGGAATTCTAAACTAGATGATCTGGGCT1679          
CTCTGCACCATTCATTGTGGCAGTTGGGACATTTTTAGGTATAACAGACACATACACTTA1739          
GATCAATGCATCGCTGTACTCCTTGAAATCAGAGCTAGCTTGTTAGAAAAAGAATCAGAG1799          
CCAGGTATAGCGGTGCATGTCATTAATCCCAGCGCTAAAGAGACAGAGACAGGAGAATCT1859          
CTGTGAGTTCAAGGCCACATAGAAAGAGCCTGTCTCGGGAGCAGGAAAAAAAAAAAAAAC1919          
GGAATTC1926                                                               
(2) INFORMATION FOR SEQ ID NO:23:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 399 amino acids                                               
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:                                  
MetAlaMetArgProGlyProLeuTrpLeuLeuGlyLeuAlaLeuCys                          
151015                                                                    
AlaLeuGlyGlyGlyHisGlyProArgProProHisThrCysProGln                          
202530                                                                    
ArgArgLeuGlyAlaArgGluArgArgAspMetGlnArgGluIleLeu                          
354045                                                                    
AlaValLeuGlyLeuProGlyArgProArgProArgAlaGlnProAla                          
505560                                                                    
AlaAlaArgGlnProAlaSerAlaProLeuPheMetLeuAspLeuTyr                          
65707580                                                                  
HisAlaMetThrAspAspAspAspGlyGlyProProGlnAlaHisLeu                          
859095                                                                    
GlyArgAlaAspLeuValMetSerPheValAsnMetValGluArgAsp                          
100105110                                                                 
ArgThrLeuGlyTyrGlnGluProHisTrpLysGluPheHisPheAsp                          
115120125                                                                 
LeuThrGlnIleProAlaGlyGluAlaValThrAlaAlaGluPheArg                          
130135140                                                                 
IleTyrLysGluProSerThrHisProLeuAsnThrThrLeuHisIle                          
145150155160                                                              
SerMetPheGluValValGlnGluHisSerAsnArgGluSerAspLeu                          
165170175                                                                 
PhePheLeuAspLeuGlnThrLeuArgSerGlyAspGluGlyTrpLeu                          
180185190                                                                 
ValLeuAspIleThrAlaAlaSerAspArgTrpLeuLeuAsnHisHis                          
195200205                                                                 
LysAspLeuGlyLeuArgLeuTyrValGluThrAlaAspGlyHisSer                          
210215220                                                                 
MetAspProGlyLeuAlaGlyLeuLeuGlyArgGlnAlaProArgSer                          
225230235240                                                              
ArgGlnProPheMetValThrPhePheArgAlaSerGlnSerProVal                          
245250255                                                                 
ArgAlaProArgAlaAlaArgProLeuLysArgArgGlnProLysLys                          
260265270                                                                 
ThrAsnGluLeuProHisProAsnLysLeuProGlyIlePheAspAsp                          
275280285                                                                 
GlyHisGlySerArgGlyArgGluValCysArgArgHisGluLeuTyr                          
290295300                                                                 
ValSerPheArgAspLeuGlyTrpLeuAspTrpValIleAlaProGln                          
305310315320                                                              
GlyTyrSerAlaTyrTyrCysGluGlyGluCysAlaPheProLeuAsp                          
325330335                                                                 
SerCysMetAsnAlaThrAsnHisAlaIleLeuGlnSerLeuValHis                          
340345350                                                                 
LeuMetLysProAspValValProLysAlaCysCysAlaProThrLys                          
355360365                                                                 
LeuSerAlaThrSerValLeuTyrTyrAspSerSerAsnAsnValIle                          
370375380                                                                 
LeuArgLysHisArgAsnMetValValLysAlaCysGlyCysHis                             
385390395                                                                 
(2) INFORMATION FOR SEQ ID NO:24:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 1368 base pairs                                               
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: cDNA                                                  
(ix) FEATURE:                                                             
(A) NAME/KEY: CDS                                                         
(B) LOCATION: 1..1365                                                     
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:                                  
ATGTCGGGACTGCGAAACACCTCGGAGGCCGTTGCAGTGCTCGCCTCC48                        
MetSerGlyLeuArgAsnThrSerGluAlaValAlaValLeuAlaSer                          
151015                                                                    
CTGGGACTCGGAATGGTTCTGCTCATGTTCGTGGCGACCACGCCGCCG96                        
LeuGlyLeuGlyMetValLeuLeuMetPheValAlaThrThrProPro                          
202530                                                                    
GCCGTTGAGGCCACCCAGTCGGGGATTTACATAGACAACGGCAAGGAC144                       
AlaValGluAlaThrGlnSerGlyIleTyrIleAspAsnGlyLysAsp                          
354045                                                                    
CAGACGATCATGCACAGAGTGCTGAGCGAGGACGACAAGCTGGACGTC192                       
GlnThrIleMetHisArgValLeuSerGluAspAspLysLeuAspVal                          
505560                                                                    
TCGTACGAGATCCTCGAGTTCCTGGGCATCGCCGAACGGCCGACGCAC240                       
SerTyrGluIleLeuGluPheLeuGlyIleAlaGluArgProThrHis                          
65707580                                                                  
CTGAGCAGCCACCAGTTGTCGCTGAGGAAGTCGGCTCCCAAGTTCCTG288                       
LeuSerSerHisGlnLeuSerLeuArgLysSerAlaProLysPheLeu                          
859095                                                                    
CTGGACGTCTACCACCGCATCACGGCGGAGGAGGGTCTCAGCGATCAG336                       
LeuAspValTyrHisArgIleThrAlaGluGluGlyLeuSerAspGln                          
100105110                                                                 
GATGAGGACGACGACTACGAACGCGGCCATCGGTCCAGGAGGAGCGCC384                       
AspGluAspAspAspTyrGluArgGlyHisArgSerArgArgSerAla                          
115120125                                                                 
GACCTCGAGGAGGATGAGGGCGAGCAGCAGAAGAACTTCATCACCGAC432                       
AspLeuGluGluAspGluGlyGluGlnGlnLysAsnPheIleThrAsp                          
130135140                                                                 
CTGGACAAGCGGGCCATCGACGAGAGCGACATCATCATGACCTTCCTG480                       
LeuAspLysArgAlaIleAspGluSerAspIleIleMetThrPheLeu                          
145150155160                                                              
AACAAGCGCCACCACAATGTGGACGAACTGCGTCACGAGCACGGCCGT528                       
AsnLysArgHisHisAsnValAspGluLeuArgHisGluHisGlyArg                          
165170175                                                                 
CGCCTGTGGTTCGACGTCTCCAACGTGCCCAACGACAACTACCTGGTG576                       
ArgLeuTrpPheAspValSerAsnValProAsnAspAsnTyrLeuVal                          
180185190                                                                 
ATGGCCGAGCTGCGCATCTATCAGAACGCCAACGAGGGCAAGTGGCTG624                       
MetAlaGluLeuArgIleTyrGlnAsnAlaAsnGluGlyLysTrpLeu                          
195200205                                                                 
ACCGCCAACAGGGAGTTCACCATCACGGTATACGCCATTGGCACCGGC672                       
ThrAlaAsnArgGluPheThrIleThrValTyrAlaIleGlyThrGly                          
210215220                                                                 
ACGCTGGGCCAGCACACCATGGAGCCGCTGTCCTCGGTGAACACCACC720                       
ThrLeuGlyGlnHisThrMetGluProLeuSerSerValAsnThrThr                          
225230235240                                                              
GGGGACTACGTGGGCTGGTTGGAGCTCAACGTGACCGAGGGCCTGCAC768                       
GlyAspTyrValGlyTrpLeuGluLeuAsnValThrGluGlyLeuHis                          
245250255                                                                 
GAGTGGCTGGTCAAGTCGAAGGACAATCATGGCATCTACATTGGAGCA816                       
GluTrpLeuValLysSerLysAspAsnHisGlyIleTyrIleGlyAla                          
260265270                                                                 
CACGCTGTCAACCGACCCGACCGCGAGGTGAAGCTGGACGACATTGGA864                       
HisAlaValAsnArgProAspArgGluValLysLeuAspAspIleGly                          
275280285                                                                 
CTGATCCACCGCAAGGTGGACGACGAGTTCCAGCCCTTCATGATCGGC912                       
LeuIleHisArgLysValAspAspGluPheGlnProPheMetIleGly                          
290295300                                                                 
TTCTTCCGCGGACCGGAGCTGATCAAGGCGACGGCCCACAGCAGCCAC960                       
PhePheArgGlyProGluLeuIleLysAlaThrAlaHisSerSerHis                          
305310315320                                                              
CACAGGAGCAAGCGAAGCGCCAGCCATCCACGCAAGCGCAAGAAGTCG1008                      
HisArgSerLysArgSerAlaSerHisProArgLysArgLysLysSer                          
325330335                                                                 
GTGTCGCCCAACAACGTGCCGCTGCTGGAACCGATGGAGAGCACGCGC1056                      
ValSerProAsnAsnValProLeuLeuGluProMetGluSerThrArg                          
340345350                                                                 
AGCTGCCAGATGCAGACCCTGTACATAGACTTCAAGGATCTGGGCTGG1104                      
SerCysGlnMetGlnThrLeuTyrIleAspPheLysAspLeuGlyTrp                          
355360365                                                                 
CATGACTGGATCATCGCACCAGAGGGCTATGGCGCCTTCTACTGCAGC1152                      
HisAspTrpIleIleAlaProGluGlyTyrGlyAlaPheTyrCysSer                          
370375380                                                                 
GGCGAGTGCAATTTCCCGCTCAATGCGCACATGAACGCCACGAACCAT1200                      
GlyGluCysAsnPheProLeuAsnAlaHisMetAsnAlaThrAsnHis                          
385390395400                                                              
GCGATCGTCCAGACCCTGGTCCACCTGCTGGAGCCCAAGAAGGTGCCC1248                      
AlaIleValGlnThrLeuValHisLeuLeuGluProLysLysValPro                          
405410415                                                                 
AAGCCCTGCTGCGCTCCGACCAGGCTGGGAGCACTACCCGTTCTGTAC1296                      
LysProCysCysAlaProThrArgLeuGlyAlaLeuProValLeuTyr                          
420425430                                                                 
CACCTGAACGACGAGAATGTGAACCTGAAAAAGTATAGAAACATGATT1344                      
HisLeuAsnAspGluAsnValAsnLeuLysLysTyrArgAsnMetIle                          
435440445                                                                 
GTGAAATCCTGCGGGTGCCATTGA1368                                              
ValLysSerCysGlyCysHis                                                     
450455                                                                    
(2) INFORMATION FOR SEQ ID NO:25:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 455 amino acids                                               
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:                                  
MetSerGlyLeuArgAsnThrSerGluAlaValAlaValLeuAlaSer                          
151015                                                                    
LeuGlyLeuGlyMetValLeuLeuMetPheValAlaThrThrProPro                          
202530                                                                    
AlaValGluAlaThrGlnSerGlyIleTyrIleAspAsnGlyLysAsp                          
354045                                                                    
GlnThrIleMetHisArgValLeuSerGluAspAspLysLeuAspVal                          
505560                                                                    
SerTyrGluIleLeuGluPheLeuGlyIleAlaGluArgProThrHis                          
65707580                                                                  
LeuSerSerHisGlnLeuSerLeuArgLysSerAlaProLysPheLeu                          
859095                                                                    
LeuAspValTyrHisArgIleThrAlaGluGluGlyLeuSerAspGln                          
100105110                                                                 
AspGluAspAspAspTyrGluArgGlyHisArgSerArgArgSerAla                          
115120125                                                                 
AspLeuGluGluAspGluGlyGluGlnGlnLysAsnPheIleThrAsp                          
130135140                                                                 
LeuAspLysArgAlaIleAspGluSerAspIleIleMetThrPheLeu                          
145150155160                                                              
AsnLysArgHisHisAsnValAspGluLeuArgHisGluHisGlyArg                          
165170175                                                                 
ArgLeuTrpPheAspValSerAsnValProAsnAspAsnTyrLeuVal                          
180185190                                                                 
MetAlaGluLeuArgIleTyrGlnAsnAlaAsnGluGlyLysTrpLeu                          
195200205                                                                 
ThrAlaAsnArgGluPheThrIleThrValTyrAlaIleGlyThrGly                          
210215220                                                                 
ThrLeuGlyGlnHisThrMetGluProLeuSerSerValAsnThrThr                          
225230235240                                                              
GlyAspTyrValGlyTrpLeuGluLeuAsnValThrGluGlyLeuHis                          
245250255                                                                 
GluTrpLeuValLysSerLysAspAsnHisGlyIleTyrIleGlyAla                          
260265270                                                                 
HisAlaValAsnArgProAspArgGluValLysLeuAspAspIleGly                          
275280285                                                                 
LeuIleHisArgLysValAspAspGluPheGlnProPheMetIleGly                          
290295300                                                                 
PhePheArgGlyProGluLeuIleLysAlaThrAlaHisSerSerHis                          
305310315320                                                              
HisArgSerLysArgSerAlaSerHisProArgLysArgLysLysSer                          
325330335                                                                 
ValSerProAsnAsnValProLeuLeuGluProMetGluSerThrArg                          
340345350                                                                 
SerCysGlnMetGlnThrLeuTyrIleAspPheLysAspLeuGlyTrp                          
355360365                                                                 
HisAspTrpIleIleAlaProGluGlyTyrGlyAlaPheTyrCysSer                          
370375380                                                                 
GlyGluCysAsnPheProLeuAsnAlaHisMetAsnAlaThrAsnHis                          
385390395400                                                              
AlaIleValGlnThrLeuValHisLeuLeuGluProLysLysValPro                          
405410415                                                                 
LysProCysCysAlaProThrArgLeuGlyAlaLeuProValLeuTyr                          
420425430                                                                 
HisLeuAsnAspGluAsnValAsnLeuLysLysTyrArgAsnMetIle                          
435440445                                                                 
ValLysSerCysGlyCysHis                                                     
450455                                                                    
(2) INFORMATION FOR SEQ ID NO:26:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 104 amino acids                                               
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(ix) FEATURE:                                                             
(A) NAME/KEY: Protein                                                     
(B) LOCATION: 1..104                                                      
(D) OTHER INFORMATION: /label= BMP3                                       
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:                                  
CysAlaArgArgTyrLeuLysValAspPheAlaAspIleGlyTrpSer                          
151015                                                                    
GluTrpIleIleSerProLysSerPheAspAlaTyrTyrCysSerGly                          
202530                                                                    
AlaCysGlnPheProMetProLysSerLeuLysProSerAsnHisAla                          
354045                                                                    
ThrIleGlnSerIleValAlaArgAlaValGlyValValProGlyIle                          
505560                                                                    
ProGluProCysCysValProGluLysMetSerSerLeuSerIleLeu                          
65707580                                                                  
PhePheAspGluAsnLysAsnValValLeuLysValTyrProAsnMet                          
859095                                                                    
ThrValGluSerCysAlaCysArg                                                  
100                                                                       
(2) INFORMATION FOR SEQ ID NO:27:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 102 amino acids                                               
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(ix) FEATURE:                                                             
(A) NAME/KEY: Protein                                                     
(B) LOCATION: 1..102                                                      
(D) OTHER INFORMATION: /label= BMP5                                       
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:                                  
CysLysLysHisGluLeuTyrValSerPheArgAspLeuGlyTrpGln                          
151015                                                                    
AspTrpIleIleAlaProGluGlyTyrAlaAlaPheTyrCysAspGly                          
202530                                                                    
GluCysSerPheProLeuAsnAlaHisMetAsnAlaThrAsnHisAla                          
354045                                                                    
IleValGlnThrLeuValHisLeuMetPheProAspHisValProLys                          
505560                                                                    
ProCysCysAlaProThrLysLeuAsnAlaIleSerValLeuTyrPhe                          
65707580                                                                  
AspAspSerSerAsnValIleLeuLysLysTyrArgAsnMetValVal                          
859095                                                                    
ArgSerCysGlyCysHis                                                        
100                                                                       
(2) INFORMATION FOR SEQ ID NO:28:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 102 amino acids                                               
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(ix) FEATURE:                                                             
(A) NAME/KEY: Protein                                                     
(B) LOCATION: 1..102                                                      
(D) OTHER INFORMATION: /label= BMP6                                       
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:                                  
CysArgLysHisGluLeuTyrValSerPheGlnAspLeuGlyTrpGln                          
151015                                                                    
AspTrpIleIleAlaProLysGlyTyrAlaAlaAsnTyrCysAspGly                          
202530                                                                    
GluCysSerPheProLeuAsnAlaHisMetAsnAlaThrAsnHisAla                          
354045                                                                    
IleValGlnThrLeuValHisLeuMetAsnProGluTyrValProLys                          
505560                                                                    
ProCysCysAlaProThrLysLeuAsnAlaIleSerValLeuTyrPhe                          
65707580                                                                  
AspAspAsnSerAsnValIleLeuLysLysTyrArgTrpMetValVal                          
859095                                                                    
ArgAlaCysGlyCysHis                                                        
100                                                                       
(2) INFORMATION FOR SEQ ID NO:29:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 102 amino acids                                               
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(ix) FEATURE:                                                             
(A) NAME/KEY: Protein                                                     
(B) LOCATION: 1..102                                                      
(D) OTHER INFORMATION: /label= OPX                                        
/note= "WHEREIN XAA AT EACH POS'N IS INDEPENDENTLY                        
SELECTED FROM THE RESIDUES OCCURING AT THE CORRESPONDING                  
POS'N IN THE C-TERMINAL SEQUENCE OF MOUSE OR HUMAN OP1                    
OR OP2 (SEQ. ID NOS. 5,6,7&8 OR 16,18, 20&22"                             
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:                                  
CysXaaXaaHisGluLeuTyrValXaaPheXaaAspLeuGlyTrpXaa                          
151015                                                                    
AspTrpXaaIleAlaProXaaGlyTyrXaaAlaTyrTyrCysGluGly                          
202530                                                                    
GluCysXaaPheProLeuXaaSerXaaMetAsnAlaThrAsnHisAla                          
354045                                                                    
IleXaaGlnXaaLeuValHisXaaXaaXaaProXaaXaaValProLys                          
505560                                                                    
XaaCysCysAlaProThrXaaLeuXaaAlaXaaSerValLeuTyrXaa                          
65707580                                                                  
AspXaaSerXaaAsnValXaaLeuXaaLysXaaArgAsnMetValVal                          
859095                                                                    
XaaAlaCysGlyCysHis                                                        
100                                                                       
(2) INFORMATION FOR SEQ ID NO:30:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 97 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(ix) FEATURE:                                                             
(A) NAME/KEY: Protein                                                     
(B) LOCATION: 1..97                                                       
(D) OTHER INFORMATION: /label= GENERIC-SEQ-5                              
/note= "WHEREIN EACH XAA IS INDEPENDENTLY SELECTED FROM                   
A GROUP OF ONE OR MORE SPECIFIED AMINO ACIDS AS DEFINED                   
IN THE SPECIFICATION"                                                     
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:                                  
LeuXaaXaaXaaPheXaaXaaXaaGlyTrpXaaXaaTrpXaaXaaXaa                          
151015                                                                    
ProXaaXaaXaaXaaAlaXaaTyrCysXaaGlyXaaCysXaaXaaPro                          
202530                                                                    
XaaXaaXaaXaaXaaXaaXaaXaaAsnHisAlaXaaXaaXaaXaaXaa                          
354045                                                                    
XaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaCysCysXaaPro                          
505560                                                                    
XaaXaaXaaXaaXaaXaaXaaXaaLeuXaaXaaXaaXaaXaaXaaXaa                          
65707580                                                                  
ValXaaLeuXaaXaaXaaXaaXaaMetXaaValXaaXaaCysXaaCys                          
859095                                                                    
Xaa                                                                       
(2) INFORMATION FOR SEQ ID NO:31:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 102 amino acids                                               
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(ix) FEATURE:                                                             
(A) NAME/KEY: Protein                                                     
(B) LOCATION: 1..102                                                      
(D) OTHER INFORMATION: /label= GENERIC-SEQ-6                              
/note= "WHEREIN EACH XAA IS INDEPENDENTLY SELECTED FROM                   
A GROUP OF ONE OR MORE SPECIFIED AMINO ACIDS AS DEFINED                   
IN THE SPECIFICATION"                                                     
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:                                  
CysXaaXaaXaaXaaLeuXaaXaaXaaPheXaaXaaXaaGlyTrpXaa                          
151015                                                                    
XaaTrpXaaXaaXaaProXaaXaaXaaXaaAlaXaaTyrCysXaaGly                          
202530                                                                    
XaaCysXaaXaaProXaaXaaXaaXaaXaaXaaXaaXaaAsnHisAla                          
354045                                                                    
XaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaa                          
505560                                                                    
XaaCysCysXaaProXaaXaaXaaXaaXaaXaaXaaXaaLeuXaaXaa                          
65707580                                                                  
XaaXaaXaaXaaXaaValXaaLeuXaaXaaXaaXaaXaaMetXaaVal                          
859095                                                                    
XaaXaaCysXaaCysXaa                                                        
100                                                                       
(2) INFORMATION FOR SEQ ID NO:32:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 1247 base pairs                                               
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: cDNA                                                  
(ix) FEATURE:                                                             
(A) NAME/KEY: CDS                                                         
(B) LOCATION: 84..1199                                                    
(D) OTHER INFORMATION: /product= "GDF-1"                                  
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:                                  
GGGGACACCGGCCCCGCCCTCAGCCCACTGGTCCCGGGCCGCCGCGGACCCTGCGCACTC60            
TCTGGTCATCGCCTGGGAGGAAGATGCCACCGCCGCAGCAAGGTCCCTGC110                     
MetProProProGlnGlnGlyProCys                                               
15                                                                        
GGCCACCACCTCCTCCTCCTCCTGGCCCTGCTGCTGCCCTCGCTGCCC158                       
GlyHisHisLeuLeuLeuLeuLeuAlaLeuLeuLeuProSerLeuPro                          
10152025                                                                  
CTGACCCGCGCCCCCGTGCCCCCAGGCCCAGCCGCCGCCCTGCTCCAG206                       
LeuThrArgAlaProValProProGlyProAlaAlaAlaLeuLeuGln                          
303540                                                                    
GCTCTAGGACTGCGCGATGAGCCCCAGGGTGCCCCCAGGCTCCGGCCG254                       
AlaLeuGlyLeuArgAspGluProGlnGlyAlaProArgLeuArgPro                          
455055                                                                    
GTTCCCCCGGTCATGTGGCGCCTGTTTCGACGCCGGGACCCCCAGGAG302                       
ValProProValMetTrpArgLeuPheArgArgArgAspProGlnGlu                          
606570                                                                    
ACCAGGTCTGGCTCGCGGCGGACGTCCCCAGGGGTCACCCTGCAACCG350                       
ThrArgSerGlySerArgArgThrSerProGlyValThrLeuGlnPro                          
758085                                                                    
TGCCACGTGGAGGAGCTGGGGGTCGCCGGAAACATCGTGCGCCACATC398                       
CysHisValGluGluLeuGlyValAlaGlyAsnIleValArgHisIle                          
9095100105                                                                
CCGGACCGCGGTGCGCCCACCCGGGCCTCGGAGCCTGTCTCGGCCGCG446                       
ProAspArgGlyAlaProThrArgAlaSerGluProValSerAlaAla                          
110115120                                                                 
GGGCATTGCCCTGAGTGGACAGTCGTCTTCGACCTGTCGGCTGTGGAA494                       
GlyHisCysProGluTrpThrValValPheAspLeuSerAlaValGlu                          
125130135                                                                 
CCCGCTGAGCGCCCGAGCCGGGCCCGCCTGGAGCTGCGTTTCGCGGCG542                       
ProAlaGluArgProSerArgAlaArgLeuGluLeuArgPheAlaAla                          
140145150                                                                 
GCGGCGGCGGCAGCCCCGGAGGGCGGCTGGGAGCTGAGCGTGGCGCAA590                       
AlaAlaAlaAlaAlaProGluGlyGlyTrpGluLeuSerValAlaGln                          
155160165                                                                 
GCGGGCCAGGGCGCGGGCGCGGACCCCGGGCCGGTGCTGCTCCGCCAG638                       
AlaGlyGlnGlyAlaGlyAlaAspProGlyProValLeuLeuArgGln                          
170175180185                                                              
TTGGTGCCCGCCCTGGGGCCGCCAGTGCGCGCGGAGCTGCTGGGCGCC686                       
LeuValProAlaLeuGlyProProValArgAlaGluLeuLeuGlyAla                          
190195200                                                                 
GCTTGGGCTCGCAACGCCTCATGGCCGCGCAGCCTCCGCCTGGCGCTG734                       
AlaTrpAlaArgAsnAlaSerTrpProArgSerLeuArgLeuAlaLeu                          
205210215                                                                 
GCGCTACGCCCCCGGGCCCCTGCCGCCTGCGCGCGCCTGGCCGAGGCC782                       
AlaLeuArgProArgAlaProAlaAlaCysAlaArgLeuAlaGluAla                          
220225230                                                                 
TCGCTGCTGCTGGTGACCCTCGACCCGCGCCTGTGCCACCCCCTGGCC830                       
SerLeuLeuLeuValThrLeuAspProArgLeuCysHisProLeuAla                          
235240245                                                                 
CGGCCGCGGCGCGACGCCGAACCCGTGTTGGGCGGCGGCCCCGGGGGC878                       
ArgProArgArgAspAlaGluProValLeuGlyGlyGlyProGlyGly                          
250255260265                                                              
GCTTGTCGCGCGCGGCGGCTGTACGTGAGCTTCCGCGAGGTGGGCTGG926                       
AlaCysArgAlaArgArgLeuTyrValSerPheArgGluValGlyTrp                          
270275280                                                                 
CACCGCTGGGTCATCGCGCCGCGCGGCTTCCTGGCCAACTACTGCCAG974                       
HisArgTrpValIleAlaProArgGlyPheLeuAlaAsnTyrCysGln                          
285290295                                                                 
GGTCAGTGCGCGCTGCCCGTCGCGCTGTCGGGGTCCGGGGGGCCGCCG1022                      
GlyGlnCysAlaLeuProValAlaLeuSerGlySerGlyGlyProPro                          
300305310                                                                 
GCGCTCAACCACGCTGTGCTGCGCGCGCTCATGCACGCGGCCGCCCCG1070                      
AlaLeuAsnHisAlaValLeuArgAlaLeuMetHisAlaAlaAlaPro                          
315320325                                                                 
GGAGCCGCCGACCTGCCCTGCTGCGTGCCCGCGCGCCTGTCGCCCATC1118                      
GlyAlaAlaAspLeuProCysCysValProAlaArgLeuSerProIle                          
330335340345                                                              
TCCGTGCTCTTCTTTGACAACAGCGACAACGTGGTGCTGCGGCAGTAT1166                      
SerValLeuPhePheAspAsnSerAspAsnValValLeuArgGlnTyr                          
350355360                                                                 
GAGGACATGGTGGTGGACGAGTGCGGCTGCCGCTAACCCGGGGCGGGCAGGGA1219                 
GluAspMetValValAspGluCysGlyCysArg                                         
365370                                                                    
CCCGGGCCCAACAATAAATGCCGCGTGG1247                                          
(2) INFORMATION FOR SEQ ID NO:33:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 372 amino acids                                               
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:                                  
MetProProProGlnGlnGlyProCysGlyHisHisLeuLeuLeuLeu                          
151015                                                                    
LeuAlaLeuLeuLeuProSerLeuProLeuThrArgAlaProValPro                          
202530                                                                    
ProGlyProAlaAlaAlaLeuLeuGlnAlaLeuGlyLeuArgAspGlu                          
354045                                                                    
ProGlnGlyAlaProArgLeuArgProValProProValMetTrpArg                          
505560                                                                    
LeuPheArgArgArgAspProGlnGluThrArgSerGlySerArgArg                          
65707580                                                                  
ThrSerProGlyValThrLeuGlnProCysHisValGluGluLeuGly                          
859095                                                                    
ValAlaGlyAsnIleValArgHisIleProAspArgGlyAlaProThr                          
100105110                                                                 
ArgAlaSerGluProValSerAlaAlaGlyHisCysProGluTrpThr                          
115120125                                                                 
ValValPheAspLeuSerAlaValGluProAlaGluArgProSerArg                          
130135140                                                                 
AlaArgLeuGluLeuArgPheAlaAlaAlaAlaAlaAlaAlaProGlu                          
145150155160                                                              
GlyGlyTrpGluLeuSerValAlaGlnAlaGlyGlnGlyAlaGlyAla                          
165170175                                                                 
AspProGlyProValLeuLeuArgGlnLeuValProAlaLeuGlyPro                          
180185190                                                                 
ProValArgAlaGluLeuLeuGlyAlaAlaTrpAlaArgAsnAlaSer                          
195200205                                                                 
TrpProArgSerLeuArgLeuAlaLeuAlaLeuArgProArgAlaPro                          
210215220                                                                 
AlaAlaCysAlaArgLeuAlaGluAlaSerLeuLeuLeuValThrLeu                          
225230235240                                                              
AspProArgLeuCysHisProLeuAlaArgProArgArgAspAlaGlu                          
245250255                                                                 
ProValLeuGlyGlyGlyProGlyGlyAlaCysArgAlaArgArgLeu                          
260265270                                                                 
TyrValSerPheArgGluValGlyTrpHisArgTrpValIleAlaPro                          
275280285                                                                 
ArgGlyPheLeuAlaAsnTyrCysGlnGlyGlnCysAlaLeuProVal                          
290295300                                                                 
AlaLeuSerGlySerGlyGlyProProAlaLeuAsnHisAlaValLeu                          
305310315320                                                              
ArgAlaLeuMetHisAlaAlaAlaProGlyAlaAlaAspLeuProCys                          
325330335                                                                 
CysValProAlaArgLeuSerProIleSerValLeuPhePheAspAsn                          
340345350                                                                 
SerAspAsnValValLeuArgGlnTyrGluAspMetValValAspGlu                          
355360365                                                                 
CysGlyCysArg                                                              
370                                                                       
__________________________________________________________________________

Claims (19)

What is claimed is:
1. A method for inducing regeneration of lost or damaged hepatic tissue in a mammal, the method comprising the step of:
administering a morphogen to a locus of said damaged or lost tissue under conditions such that said morphogen induces tissue-specific regeneration thereat,
said morphogen comprising a dimeric protein having the following properties:
inducing a cascade of tissue-specific morphogenesis culminating in the formation of mammalian bone or liver tissue, and
comprising a pair of folded polypeptides, the amino acid sequence of each of which comprises a sequence sharing at least 70% amino acid sequence homology with the C-terminal seven-cysteine domain of human OP-1, residues 38-139 of Seq. ID No. 5.
2. The method of claim 1 wherein said morphogen is absorbed on a biocompatible, acellular matrix and administered locally to said locus.
3. The method of claim 2 wherein said matrix has components specific for hepatic tissue.
4. The method of claim 2 wherein said matrix is biodegradable.
5. The method of claim 2 wherein said matrix is derived from hepatic tissue.
6. The method of claim 2 wherein said matrix comprises liver specific collagen and liver specific cell attachment factors.
7. The method of claim 2 wherein said matrix comprises a synthetic polymeric material.
8. The method of claim 7 wherein said polymeric material comprises polylactic acid, polybutyric acid, polyglycolic acid, polyanhydride, or copolymers thereof.
9. The method of claim 2 wherein said matrix comprises pores of a dimension sufficient to permit the influx, differentiation and proliferation of migratory progenitor cells from the body of said mammal.
10. The method of claim 1 wherein the amino acid sequences of said morphogen polypeptides comprise an amino acid sequence sharing at least 80% homology with said C-terminal seven-cysteine domain of human OP-1.
11. The method of claim 10 wherein greater than 60% of the amino acid residues within said amino acid sequence sharing at least 80% homology with said domain of human OP-1 are identical to the corresponding aligned residues of said domain of human OP-1.
12. The method of claim 11 wherein greater than 65% of the amino acid residues within said amino acid sequence sharing at least 80% homology with said domain of human OP-1 are identical to the corresponding aligned residues of said domain of human OP-1.
13. The method of claim 12 wherein each of the amino acid residues within said amino acid sequence of at least one of said morphogen polypeptides is identical to, or is a conservative substution of, the corresponding aligned residue of said domain of human OP-1.
14. The method of claim 1 wherein said morphogen polypeptides are associated with morphogen prodomain polypeptides.
15. The method of claim 14 wherein the amino acid sequences of said morphogen prodomain polypeptides comprise residues 30-292 of Seq ID No. 17.
16. A method for inducing regeneration of lost or damaged hepatic tissue in a mammal, the method comprising the step of:
administering a morphogen to a locus of said damaged or lost tissue under conditions such that said morphogen induces tissue-specific regeneration thereat,
said morphogen comprising a dimeric protein having the following properties:
inducing a cascade of tissue-specific morphogenesis culminating in the formation of mammalian bone or liver tissue, and
comprising a pair of polypeptides, the amino acid sequence of each of which comprises a sequence defined by Generic Sequence 6, Seq.
ID No. 31.
17. The method of claim 16 wherein said sequences of said pair of morphogen polypeptides are defined by OPX, Seq. ID No. 29.
18. The method of claim 1 or 16 wherein said morphogen is obtained from milk, serum or culture supernatant of morphogen-secreting mammalian cells.
19. The method of claim 1 or 16 wherein the amino acid sequences of both of said morphogen polypeptides comprise a sequence selected from the sequences of the group consisting of C-terminal seven-cysteine domains of human OP-1, mouse OP-1, human OP-2, mouse OP-2, DPP, Vgl, Vgr-1, CBMP2A, CBMP2B, BMP3, GDF-1, 60A, BMP5 or BMP6 (Seq. ID Nos. 5 (residues 38-139), 6 (residues 38-139), 7 (residues 38-139), 8 (residues 38-139), 9, 10, 11, 12, 13, 14, 25 (residues 354-455), 26, 27 and 28, respectively); or,
conservative substitution variants of any of said sequences, provided that any said conservative substitution variant, when dimerized, induces a cascade of tissue-specific morphogenesis culminating in the formation of mammalian bone or liver tissue.
US08/445,468 1991-03-11 1995-05-22 Morphogen-induced liver regeneration Expired - Lifetime US5849686A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US08/445,468 US5849686A (en) 1991-03-11 1995-05-22 Morphogen-induced liver regeneration

Applications Claiming Priority (8)

Application Number Priority Date Filing Date Title
US66727491A 1991-03-11 1991-03-11
US75305991A 1991-08-30 1991-08-30
US75276491A 1991-08-30 1991-08-30
US93833692A 1992-08-28 1992-08-28
US93833792A 1992-08-28 1992-08-28
US94623892A 1992-09-16 1992-09-16
US16554193A 1993-12-09 1993-12-09
US08/445,468 US5849686A (en) 1991-03-11 1995-05-22 Morphogen-induced liver regeneration

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US16554193A Continuation 1991-03-11 1993-12-09

Publications (1)

Publication Number Publication Date
US5849686A true US5849686A (en) 1998-12-15

Family

ID=27569098

Family Applications (1)

Application Number Title Priority Date Filing Date
US08/445,468 Expired - Lifetime US5849686A (en) 1991-03-11 1995-05-22 Morphogen-induced liver regeneration

Country Status (1)

Country Link
US (1) US5849686A (en)

Cited By (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002077206A1 (en) * 2001-03-27 2002-10-03 Vertex Pharmaceuticals Incorporated Compositiona and methods useful for hcv infection
WO2002092013A2 (en) * 2001-05-17 2002-11-21 Board Of Trustees Of The University Of Illinois Methods for treating liver disease and liver damage with growth hormone and foxm1b
US6498142B1 (en) * 1996-05-06 2002-12-24 Curis, Inc. Morphogen treatment for chronic renal failure
US6531445B1 (en) * 1991-03-11 2003-03-11 Curis, Inc. Protein-induced morphogenesis in liver tissue
US6605117B2 (en) 1990-05-29 2003-08-12 Stryker Corporation Synthetic bone matrix
US20050096339A1 (en) * 1991-03-11 2005-05-05 Thangavel Kuberasampath Morphogen-induced modulation of inflammatory response
US20050272649A1 (en) * 2002-08-28 2005-12-08 Hruska Keith A Conjoint administration of morphogens and ACE inhibitors in treatment of chronic renal failure
US20050287514A1 (en) * 2003-12-01 2005-12-29 Vertex Pharmaceuticals Incorporated Compositions and methods useful for HCV infection
US7147839B2 (en) 1998-05-29 2006-12-12 Curis, Inc. Methods for evaluating tissue morphogenesis and activity
EP1988395A1 (en) 1997-05-30 2008-11-05 Curis, Inc. Methods for evaluating tissue morphogenesis and morphogenic activity
US20090075376A1 (en) * 2004-06-22 2009-03-19 The Board Of Trustees Of The University Of Illnois METHODS OF INHIBITING TUMOR CELL PROLIFERATION WITH FOXM1 siRNA
US7557078B1 (en) * 1991-03-11 2009-07-07 Stryker Corporation Morphogen-induced nerve regeneration and repair
US7635673B2 (en) 2003-03-25 2009-12-22 The Board Of Trustees Of The University Of Illinois Methods of inhibiting tumor cell proliferation
US20100056441A1 (en) * 2006-03-17 2010-03-04 Costa Robert H Method for Inhibiting Angiogenesis
US20100105621A1 (en) * 1997-05-05 2010-04-29 Stryker Corporation Therapies for acute renal failure
US7763270B2 (en) 2002-09-10 2010-07-27 Scil Technology Gmbh Metal implant coated under reduced oxygen concentration with osteoinductive protein
WO2010093941A2 (en) 2009-02-12 2010-08-19 Stryker Corporation COMPOSITIONS AND METHODS FOR MINIMALLY-INVASIVE SYSTEMIC DELIVERY OF PROTEINS INCLUDING TGF-β SUPERFAMILY MEMBERS
WO2010093925A2 (en) 2009-02-12 2010-08-19 Stryker Corporation PERIPHERAL ADMINISTRATION OF PROTEINS INCLUDING TGF-β SUPERFAMILY MEMBERS FOR TREATMENT OF SYSTEMIC DISORDERS AND DISEASE
WO2010103070A2 (en) 2009-03-12 2010-09-16 Charité - Universitätsmedizin Berlin Bone morphogenetic protein 2 (bmp2) variants with reduced bmp antagonist sensitivity
WO2011035094A1 (en) 2009-09-17 2011-03-24 Stryker Corporation Buffers for controlling the ph of bone morphogenetic proteins
WO2011087768A1 (en) 2009-12-22 2011-07-21 Stryker Corporation Bmp-7 variants with reduced immunogenicity
WO2012023113A2 (en) 2010-08-20 2012-02-23 Wyeth Llc Designer osteogenic proteins
US8546334B2 (en) 2001-11-19 2013-10-01 Scil Technology Gmbh Device having osteoinductive and osteoconductive properties
EP2784083A1 (en) 2013-03-28 2014-10-01 Charité - Universitätsmedizin Berlin Bone Morphogenetic Protein (BMP) variants with highly reduced antagonist sensitivity and enhanced specific biological activity
WO2016111713A1 (en) 2015-01-05 2016-07-14 Wyeth Llc Improved osteogenic proteins
WO2018035377A1 (en) 2016-08-17 2018-02-22 Factor Bioscience Inc. Nucleic acid products and methods of administration thereof
EP3543339A1 (en) 2015-02-13 2019-09-25 Factor Bioscience Inc. Nucleic acid products and methods of administration thereof

Citations (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4309412A (en) * 1978-03-01 1982-01-05 Ryuichi Sato Germanium-containing organic polymer and its use in the treatment of liver disorders
US4396601A (en) * 1980-03-26 1983-08-02 The Regents Of The University Of Calif. Gene transfer in intact mammals
EP0148155A2 (en) * 1984-01-04 1985-07-10 International Genetic Engineering, Inc. (Ingene) Osteogenic factors
WO1988000205A1 (en) * 1986-07-01 1988-01-14 Genetics Institute, Inc. Novel osteoinductive compositions
WO1988003785A1 (en) * 1986-11-20 1988-06-02 Vacanti Joseph P Chimeric neomorphogenesis of organs by controlled cellular implantation using artificial matrices
US4775675A (en) * 1985-06-18 1988-10-04 Biogal Gyogyszergyar Thiazolidinecarboxylic acid derivatives and treatment of liver diseases therewith
US4868116A (en) * 1985-07-05 1989-09-19 Whitehead Institute For Biomedical Research Introduction and expression of foreign genetic material in epithelial cells
US4870009A (en) * 1982-11-22 1989-09-26 The Salk Institute For Biological Studies Method of obtaining gene product through the generation of transgenic animals
WO1989009788A2 (en) * 1988-04-08 1989-10-19 Creative Biomolecules, Inc. Biosynthetic osteogenic proteins and osteogenic devices containing them
US4877864A (en) * 1987-03-26 1989-10-31 Genetics Institute, Inc. Osteoinductive factors
WO1989010409A1 (en) * 1988-04-08 1989-11-02 Genetics Institute, Inc. Bone and cartilage inductive compositions
WO1990003733A1 (en) * 1988-10-11 1990-04-19 International Genetic Engineering, Inc. Osteogenic factors
WO1990010018A1 (en) * 1989-02-23 1990-09-07 Creative Biomolecules, Inc. Bone collagen matrix for implants
WO1990012604A1 (en) * 1989-04-25 1990-11-01 Vacanti Joseph P Method for implanting large volumes of cells on polymeric matrices
WO1990012603A1 (en) * 1989-04-17 1990-11-01 Vacanti Joseph P Neomorphogenesis of cartilage in vivo from cell culture
US4968590A (en) * 1988-04-08 1990-11-06 Stryker Corporation Osteogenic proteins and polypeptides
US4980286A (en) * 1985-07-05 1990-12-25 Whitehead Institute For Biomedical Research In vivo introduction and expression of foreign genetic material in epithelial cells
US4983581A (en) * 1988-05-20 1991-01-08 Institute Of Molecular Biology, Inc. Wound healing composition of IGF-I and TGF-β
EP0416578A2 (en) * 1989-09-06 1991-03-13 Takeda Chemical Industries, Ltd. Protein, DNA and use thereof
US5002965A (en) * 1989-05-09 1991-03-26 Societe De Conseils De Recherches Et D'applications Scientifiques (S.C.R.A.S.) Use of ginkgolides to prevent reperfusion injury in organ transplantation
US5011691A (en) * 1988-08-15 1991-04-30 Stryker Corporation Osteogenic devices
US5013649A (en) * 1986-07-01 1991-05-07 Genetics Institute, Inc. DNA sequences encoding osteoinductive products
US5061620A (en) * 1990-03-30 1991-10-29 Systemix, Inc. Human hematopoietic stem cell
WO1991018558A1 (en) * 1990-05-29 1991-12-12 Creative Biomolecules, Inc. Synthetic bone matrix
US5075229A (en) * 1987-06-16 1991-12-24 Ohio University Edison Animal Biotechnology Center Dietary and hormonal regulation of expression of exogenous genes in transgenic animals under control of the promoter of the gene for phosphoenolpyruvate carboxykinase
US5108989A (en) * 1990-04-04 1992-04-28 Genentech, Inc. Method of predisposing mammals to accelerated tissue repair
US5108753A (en) * 1988-04-08 1992-04-28 Creative Biomolecules Osteogenic devices
US5141905A (en) * 1986-07-01 1992-08-25 Rosen Vicki A Dna sequences encoding bmp-7 proteins

Patent Citations (31)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4309412A (en) * 1978-03-01 1982-01-05 Ryuichi Sato Germanium-containing organic polymer and its use in the treatment of liver disorders
US4396601A (en) * 1980-03-26 1983-08-02 The Regents Of The University Of Calif. Gene transfer in intact mammals
US4870009A (en) * 1982-11-22 1989-09-26 The Salk Institute For Biological Studies Method of obtaining gene product through the generation of transgenic animals
EP0148155A2 (en) * 1984-01-04 1985-07-10 International Genetic Engineering, Inc. (Ingene) Osteogenic factors
US4775675A (en) * 1985-06-18 1988-10-04 Biogal Gyogyszergyar Thiazolidinecarboxylic acid derivatives and treatment of liver diseases therewith
US4980286A (en) * 1985-07-05 1990-12-25 Whitehead Institute For Biomedical Research In vivo introduction and expression of foreign genetic material in epithelial cells
US4868116A (en) * 1985-07-05 1989-09-19 Whitehead Institute For Biomedical Research Introduction and expression of foreign genetic material in epithelial cells
WO1988000205A1 (en) * 1986-07-01 1988-01-14 Genetics Institute, Inc. Novel osteoinductive compositions
US5013649A (en) * 1986-07-01 1991-05-07 Genetics Institute, Inc. DNA sequences encoding osteoinductive products
US5141905A (en) * 1986-07-01 1992-08-25 Rosen Vicki A Dna sequences encoding bmp-7 proteins
WO1988003785A1 (en) * 1986-11-20 1988-06-02 Vacanti Joseph P Chimeric neomorphogenesis of organs by controlled cellular implantation using artificial matrices
US4877864A (en) * 1987-03-26 1989-10-31 Genetics Institute, Inc. Osteoinductive factors
US5075229A (en) * 1987-06-16 1991-12-24 Ohio University Edison Animal Biotechnology Center Dietary and hormonal regulation of expression of exogenous genes in transgenic animals under control of the promoter of the gene for phosphoenolpyruvate carboxykinase
US5108753A (en) * 1988-04-08 1992-04-28 Creative Biomolecules Osteogenic devices
WO1989010409A1 (en) * 1988-04-08 1989-11-02 Genetics Institute, Inc. Bone and cartilage inductive compositions
US4968590A (en) * 1988-04-08 1990-11-06 Stryker Corporation Osteogenic proteins and polypeptides
WO1989009787A2 (en) * 1988-04-08 1989-10-19 Creative Biomolecules, Inc. Osteogenic devices
WO1989009788A2 (en) * 1988-04-08 1989-10-19 Creative Biomolecules, Inc. Biosynthetic osteogenic proteins and osteogenic devices containing them
US4983581A (en) * 1988-05-20 1991-01-08 Institute Of Molecular Biology, Inc. Wound healing composition of IGF-I and TGF-β
US5011691A (en) * 1988-08-15 1991-04-30 Stryker Corporation Osteogenic devices
WO1990003733A1 (en) * 1988-10-11 1990-04-19 International Genetic Engineering, Inc. Osteogenic factors
US5106626A (en) * 1988-10-11 1992-04-21 International Genetic Engineering, Inc. Osteogenic factors
US4975526A (en) * 1989-02-23 1990-12-04 Creative Biomolecules, Inc. Bone collagen matrix for zenogenic implants
WO1990010018A1 (en) * 1989-02-23 1990-09-07 Creative Biomolecules, Inc. Bone collagen matrix for implants
WO1990012603A1 (en) * 1989-04-17 1990-11-01 Vacanti Joseph P Neomorphogenesis of cartilage in vivo from cell culture
WO1990012604A1 (en) * 1989-04-25 1990-11-01 Vacanti Joseph P Method for implanting large volumes of cells on polymeric matrices
US5002965A (en) * 1989-05-09 1991-03-26 Societe De Conseils De Recherches Et D'applications Scientifiques (S.C.R.A.S.) Use of ginkgolides to prevent reperfusion injury in organ transplantation
EP0416578A2 (en) * 1989-09-06 1991-03-13 Takeda Chemical Industries, Ltd. Protein, DNA and use thereof
US5061620A (en) * 1990-03-30 1991-10-29 Systemix, Inc. Human hematopoietic stem cell
US5108989A (en) * 1990-04-04 1992-04-28 Genentech, Inc. Method of predisposing mammals to accelerated tissue repair
WO1991018558A1 (en) * 1990-05-29 1991-12-12 Creative Biomolecules, Inc. Synthetic bone matrix

Non-Patent Citations (109)

* Cited by examiner, † Cited by third party
Title
2 Abstracts Rosen et al., Celeste et al., J Cell Biochem Suppl., 0 (14 Part E): 33(004, 54(105) (1990). *
3 Abstracts Wozney et al.; Celeste et al.; and Rosen et al., J Cell Biochem Suppl, 0 (16 Part F): 76(WO26); 100(W502); 103(W513) (1996). *
Abstract Q 105 D Alessandro et al., Journal Of Cellular Biochemistry, (1991). *
Abstract Q 111, Journal Of Cellular Biochemistry, (1991). *
Abstract Q-105 D'Alessandro et al., Journal Of Cellular Biochemistry, (1991).
Abstract Q-111, Journal Of Cellular Biochemistry, (1991).
Anderson, Science, 226:401 409 (1984). *
Anderson, Science, 226:401-409 (1984).
Anderson, Science, 256:808 813 (1992). *
Anderson, Science, 256:808-813 (1992).
Behringer et al., Nature, 345:167 170 (1990). *
Behringer et al., Nature, 345:167-170 (1990).
Bowie et al. 1990. Science 247:1306 1310. *
Bowie et al. 1990. Science 247:1306-1310.
Cate et al., Cell, 45:685 698 (1986). *
Cate et al., Cell, 45:685-698 (1986).
Celeste et al., PNAS, 87:9843 9847 (1990). *
Celeste et al., PNAS, 87:9843-9847 (1990).
Cone et al., PNAS, 81:6349 6353 (1984). *
Cone et al., PNAS, 81:6349-6353 (1984).
Dichek et al., Trans. Ass. Am. Physicians, 103:73 79 (1990). *
Dichek et al., Trans. Ass. Am. Physicians, 103:73-79 (1990).
Fausto et al., Clinical Applications of TGF , Wiley, Chichester, 165 177 (1991). *
Fausto et al., Clinical Applications of TGF-β, Wiley, Chichester, 165-177 (1991).
Green et al., Nature, 347:391 394 (1990). *
Green et al., Nature, 347:391-394 (1990).
Israel et al., Growth Factors, 7:139 150 (1992). *
Israel et al., Growth Factors, 7:139-150 (1992).
Karson, J. Reprod. Med., 37:508 514 (1992). *
Karson, J. Reprod. Med., 37:508-514 (1992).
Katagiri et al., Biochem Biopys Res, (172(1):295 299 (1990). *
Katagiri et al., Biochem Biopys Res, (172(1):295-299 (1990).
Lee, Molecular Endocrinology, 4:1034 1040 (1990). *
Lee, Molecular Endocrinology, 4:1034-1040 (1990).
Lee, PNAS, 88:4250 4254 (1991). *
Lee, PNAS, 88:4250-4254 (1991).
Lefer et al. (1990) Science 249:61 64. *
Lefer et al. (1990) Science 249:61-64.
Lyons et al., Genes & Development, 3:1657 1668 (1989). *
Lyons et al., Genes & Development, 3:1657-1668 (1989).
Lyons et al., PNAS, 86:4554 4558 (1989). *
Lyons et al., PNAS, 86:4554-4558 (1989).
Mason et al., Mol. Endocrinology, 3:1352 1358 (1989). *
Mason et al., Mol. Endocrinology, 3:1352-1358 (1989).
Mason et al., Nature, 318:659 663 (1985). *
Mason et al., Nature, 318:659-663 (1985).
Massagu e (1987) Cell, vol. 49, pp. 437 438. *
Massague (1987) Cell, vol. 49, pp. 437-438.
Mercola et al., New Engl. Journ. Med., 303:(22) 1297 1300 (1980). *
Mercola et al., New Engl. Journ. Med., 303:(22) 1297-1300 (1980).
Miller et al., Cancer Research, 42:3589 3594 (1987). *
Miller et al., Cancer Research, 42:3589-3594 (1987).
Ozkaynak et al., Biochem, Biophys. Res. Comm., 179:116 123 (1991). *
Ozkaynak et al., Biochem, Biophys. Res. Comm., 179:116-123 (1991).
Ozkaynak et al., Embo J., 9:2085 2093 (1990). *
Ozkaynak et al., Embo J., 9:2085-2093 (1990).
Padgett et al., Nature, 325:81 84 (1987). *
Padgett et al., Nature, 325:81-84 (1987).
Padgett et al., Proc. Natl. Acad. Sci. USA, 90:2905 2909 (1993). *
Padgett et al., Proc. Natl. Acad. Sci. USA, 90:2905-2909 (1993).
Panganiban et al., Mol. and Cell. Biol., 10:2669 2677 (1990). *
Panganiban et al., Mol. and Cell. Biol., 10:2669-2677 (1990).
Pepinsky et al. (1988) Journal of Biological Chemistry, vol. 263, pp. 18961 18964. *
Pepinsky et al. (1988) Journal of Biological Chemistry, vol. 263, pp. 18961-18964.
Rogers et al., Mol Biol Cell, 3 (2):189 196 (1992). *
Rogers et al., Mol Biol Cell, 3 (2):189-196 (1992).
Rosen et al., Connect Tissue Res, 20 (1 4):313 9 (1999). *
Rosen et al., Connect Tissue Res, 20 (1-4):313-9 (1999).
Rosen et al.; Wang et al. and Wozney et al., Calcified Tissue Int 42 (Suppl.): A35(136), A37(146,147) 3 Abstracts (1988). *
Sampath et al., J. Biol. Chem, 265:13198 13205 (1990). *
Sampath et al., J. Biol. Chem, 265:13198-13205 (1990).
Sampath et al., PNAS, 80:6591 6595 (1983). *
Sampath et al., PNAS, 80:6591-6595 (1983).
Schubert et al., Nature, 344:868 870 (1990). *
Schubert et al., Nature, 344:868-870 (1990).
Smith et al., Nature, 345:729 731 (1990). *
Smith et al., Nature, 345:729-731 (1990).
Sokol et al., Science, 249:561 564 (1990). *
Sokol et al., Science, 249:561-564 (1990).
Sporn et al. (1989) Journal of the American Medical Association, vol. 262, pp. 938 941. *
Sporn et al. (1989) Journal of the American Medical Association, vol. 262, pp. 938-941.
Takuwa et al., Biochem Biophys Res Comm, 174(1):96 101 (1991). *
Takuwa et al., Biochem Biophys Res Comm, 174(1):96-101 (1991).
Thies et al., Endocrinology, 130 (3):1318 1324 (1992). *
Thies et al., Endocrinology, 130 (3):1318-1324 (1992).
Van Thiel et al. Gastro. Clinics N. America, 17:1 18 (1988). *
Van Thiel et al. Gastro. Clinics N. America, 17:1-18 (1988).
Wahl et al. (1989) Immunology Today, vol. 10, pp. 258 261. *
Wahl et al. (1989) Immunology Today, vol. 10, pp. 258-261.
Wang et al., PNAS, 85:9484 9488 (1988). *
Wang et al., PNAS, 85:9484-9488 (1988).
Wang et al., PNAS, 87:2220 2224 (1990). *
Wang et al., PNAS, 87:2220-2224 (1990).
Weeks, Cell, 51:861 867 (1987). *
Weeks, Cell, 51:861-867 (1987).
Wharton et al., PNAS, 88:9214 9218 (1991). *
Wharton et al., PNAS, 88:9214-9218 (1991).
Wozney et al., Journal Of Cell Science Suppl., 13:149 156 (1990). *
Wozney et al., Journal Of Cell Science Suppl., 13:149-156 (1990).
Wozney et al., Mol Reprod Dev, 32 (2):160 167 (1992). *
Wozney et al., Mol Reprod Dev, 32 (2):160-167 (1992).
Wozney et al., Progress In Growth Factor Research, 1:267 280 (1990). *
Wozney et al., Progress In Growth Factor Research, 1:267-280 (1990).
Wozney et al., Science, 242:1528 1533 (1988). *
Wozney et al., Science, 242:1528-1533 (1988).
Yamaguchi et al., J Cell Biol, 113 (3):681 7 (1991). *
Yamaguchi et al., J Cell Biol, 113 (3):681-7 (1991).
Yannas, Angew. Chem. Int. Ed. Engl., 29:20 35 (1990). *
Yannas, Angew. Chem. Int. Ed. Engl., 29:20-35 (1990).

Cited By (50)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6605117B2 (en) 1990-05-29 2003-08-12 Stryker Corporation Synthetic bone matrix
US7557078B1 (en) * 1991-03-11 2009-07-07 Stryker Corporation Morphogen-induced nerve regeneration and repair
US7196056B2 (en) 1991-03-11 2007-03-27 Curis, Inc. Protein-induced morphogenesis of kidney tissue
US20050096339A1 (en) * 1991-03-11 2005-05-05 Thangavel Kuberasampath Morphogen-induced modulation of inflammatory response
US20040102373A1 (en) * 1991-03-11 2004-05-27 Curis, Inc. Protein-induced morphogenesis
US6531445B1 (en) * 1991-03-11 2003-03-11 Curis, Inc. Protein-induced morphogenesis in liver tissue
US8377878B2 (en) 1996-05-06 2013-02-19 Stryker Corporation Therapies for chronic renal failure
US6498142B1 (en) * 1996-05-06 2002-12-24 Curis, Inc. Morphogen treatment for chronic renal failure
US8017580B2 (en) 1996-05-06 2011-09-13 Stryker Corporation Therapies for chronic renal failure
US20050143304A1 (en) * 1996-05-06 2005-06-30 Curis, Inc. Novel therapies for chronic renal failure
US7524817B2 (en) 1996-05-06 2009-04-28 Stryker Corporation Therapies for chronic renal failure
US20100291170A1 (en) * 1996-05-06 2010-11-18 Stryker Corporation Novel therapies for chronic renal failure
US8748378B2 (en) 1997-05-05 2014-06-10 Stryker Corporation Therapies for acute renal failure
US20100105621A1 (en) * 1997-05-05 2010-04-29 Stryker Corporation Therapies for acute renal failure
EP1988395A1 (en) 1997-05-30 2008-11-05 Curis, Inc. Methods for evaluating tissue morphogenesis and morphogenic activity
US7147839B2 (en) 1998-05-29 2006-12-12 Curis, Inc. Methods for evaluating tissue morphogenesis and activity
WO2002077206A1 (en) * 2001-03-27 2002-10-03 Vertex Pharmaceuticals Incorporated Compositiona and methods useful for hcv infection
US8211696B2 (en) 2001-03-27 2012-07-03 Vertex Pharmaceuticals Incorporated Method useful for HCV RNA898 infection
US20020142449A1 (en) * 2001-03-27 2002-10-03 Ann Kwong Compositions and methods useful for HCV infection
US20110229874A1 (en) * 2001-03-27 2011-09-22 Vertex Pharmaceuticals Incorporated Compositions and methods useful for hcv infection
US7879606B2 (en) 2001-03-27 2011-02-01 Vertex Pharmaceuticals Incorporated Compositions and methods useful for HCV infection
WO2002092013A2 (en) * 2001-05-17 2002-11-21 Board Of Trustees Of The University Of Illinois Methods for treating liver disease and liver damage with growth hormone and foxm1b
WO2002092013A3 (en) * 2001-05-17 2004-11-04 Univ Illinois Methods for treating liver disease and liver damage with growth hormone and foxm1b
US20020187936A1 (en) * 2001-05-17 2002-12-12 Board Of Trustees For The University Of Illinois Methods of treating liver disease and liver damage with growth hormone and foxM1B
US8546334B2 (en) 2001-11-19 2013-10-01 Scil Technology Gmbh Device having osteoinductive and osteoconductive properties
US20050272649A1 (en) * 2002-08-28 2005-12-08 Hruska Keith A Conjoint administration of morphogens and ACE inhibitors in treatment of chronic renal failure
US8257728B2 (en) 2002-09-10 2012-09-04 Scil Technology Gmbh Metal implant coated under reduced oxygen concentration with osteoinductive protein
US7763270B2 (en) 2002-09-10 2010-07-27 Scil Technology Gmbh Metal implant coated under reduced oxygen concentration with osteoinductive protein
US8431522B2 (en) 2003-03-25 2013-04-30 The Board Of Trustees Of The University Of Illinois Methods of inhibiting tumor cell proliferation
US7635673B2 (en) 2003-03-25 2009-12-22 The Board Of Trustees Of The University Of Illinois Methods of inhibiting tumor cell proliferation
US20110065650A1 (en) * 2003-03-25 2011-03-17 The Board Of Trustees Of The University Of Illinois Methods of Inhibiting Tumor Cell Proliferation
US7799896B2 (en) 2003-03-25 2010-09-21 The Board Of Trustees Of The University Of Illinois Methods of inhibiting tumor cell proliferation
US20050287514A1 (en) * 2003-12-01 2005-12-29 Vertex Pharmaceuticals Incorporated Compositions and methods useful for HCV infection
US20100098663A2 (en) * 2004-06-22 2010-04-22 The Board Of Trustees Of The University Of Illinois Methods of Inhibiting Tumor Cell Proliferation with FoxM1 siRNA
US20090075376A1 (en) * 2004-06-22 2009-03-19 The Board Of Trustees Of The University Of Illnois METHODS OF INHIBITING TUMOR CELL PROLIFERATION WITH FOXM1 siRNA
US20100056441A1 (en) * 2006-03-17 2010-03-04 Costa Robert H Method for Inhibiting Angiogenesis
WO2010093941A2 (en) 2009-02-12 2010-08-19 Stryker Corporation COMPOSITIONS AND METHODS FOR MINIMALLY-INVASIVE SYSTEMIC DELIVERY OF PROTEINS INCLUDING TGF-β SUPERFAMILY MEMBERS
WO2010093925A2 (en) 2009-02-12 2010-08-19 Stryker Corporation PERIPHERAL ADMINISTRATION OF PROTEINS INCLUDING TGF-β SUPERFAMILY MEMBERS FOR TREATMENT OF SYSTEMIC DISORDERS AND DISEASE
WO2010103070A2 (en) 2009-03-12 2010-09-16 Charité - Universitätsmedizin Berlin Bone morphogenetic protein 2 (bmp2) variants with reduced bmp antagonist sensitivity
WO2011035094A1 (en) 2009-09-17 2011-03-24 Stryker Corporation Buffers for controlling the ph of bone morphogenetic proteins
WO2011087768A1 (en) 2009-12-22 2011-07-21 Stryker Corporation Bmp-7 variants with reduced immunogenicity
WO2012023113A2 (en) 2010-08-20 2012-02-23 Wyeth Llc Designer osteogenic proteins
US8952131B2 (en) 2010-08-20 2015-02-10 Wyeth Llc Designer osteogenic proteins
EP2949338A1 (en) 2010-08-20 2015-12-02 Wyeth LLC Designer osteogenic proteins
EP3320913A2 (en) 2010-08-20 2018-05-16 Wyeth LLC Designer osteogenic proteins
EP2784083A1 (en) 2013-03-28 2014-10-01 Charité - Universitätsmedizin Berlin Bone Morphogenetic Protein (BMP) variants with highly reduced antagonist sensitivity and enhanced specific biological activity
WO2016111713A1 (en) 2015-01-05 2016-07-14 Wyeth Llc Improved osteogenic proteins
EP3543339A1 (en) 2015-02-13 2019-09-25 Factor Bioscience Inc. Nucleic acid products and methods of administration thereof
EP4406585A2 (en) 2015-02-13 2024-07-31 Factor Bioscience Inc. Nucleic acid products and methods of administration thereof
WO2018035377A1 (en) 2016-08-17 2018-02-22 Factor Bioscience Inc. Nucleic acid products and methods of administration thereof

Similar Documents

Publication Publication Date Title
US5849686A (en) Morphogen-induced liver regeneration
EP0661987B1 (en) Morphogen-induced liver regeneration
EP0575555B1 (en) Protein-induced morphogenesis
US6531445B1 (en) Protein-induced morphogenesis in liver tissue
US5656593A (en) Morphogen induced periodontal tissue regeneration
EP0601106B2 (en) Morphogen-induced modulation of inflammatory response
JP3348861B2 (en) Collagen-polysaccharide matrix for bone and cartilage repair
EP0653942B2 (en) Morphogen-induced nerve regeneration and repair
US6800603B2 (en) Morphogen-induced neural cell adhesion
US6949505B1 (en) Morphogen-induced dendritic growth
US5854071A (en) OP-3- induced morphongenesis
US5739107A (en) Morphogen treatment of gastrointestinal ulcers
US7557078B1 (en) Morphogen-induced nerve regeneration and repair
CA2147598A1 (en) Op-3-induced morphogenesis
US5652118A (en) Nucleic acid encoding a novel morphogenic protein, OP-3
US6090776A (en) Morphogen treatment of organ implants
US5972884A (en) Morphogen treatment of gastrointestinal ulcers
JP4854670B2 (en) Structural skeletal engineering
US20050096339A1 (en) Morphogen-induced modulation of inflammatory response
AU7802498A (en) Methods for evaluating tissue morphogenesis and activity
US6211146B1 (en) 60A protein-induced morphogenesis

Legal Events

Date Code Title Description
STCF Information on status: patent grant

Free format text: PATENTED CASE

FEPP Fee payment procedure

Free format text: PAT HOLDER NO LONGER CLAIMS SMALL ENTITY STATUS, ENTITY STATUS SET TO UNDISCOUNTED (ORIGINAL EVENT CODE: STOL); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

FEPP Fee payment procedure

Free format text: PAYER NUMBER DE-ASSIGNED (ORIGINAL EVENT CODE: RMPN); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

Free format text: PAYOR NUMBER ASSIGNED (ORIGINAL EVENT CODE: ASPN); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

FPAY Fee payment

Year of fee payment: 4

REMI Maintenance fee reminder mailed
AS Assignment

Owner name: CURIS, INC., MASSACHUSETTS

Free format text: MERGER;ASSIGNORS:CREATIVE BIOMOLECULES, INC.;ONTOGENY, INC.;REPROGENESIS, INC.;REEL/FRAME:013798/0552

Effective date: 20000214

FPAY Fee payment

Year of fee payment: 8

AS Assignment

Owner name: STRYKER CORPORATION, MICHIGAN

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:CURIS, INC.;REEL/FRAME:021478/0778

Effective date: 20071226

FPAY Fee payment

Year of fee payment: 12

FEPP Fee payment procedure

Free format text: PAYOR NUMBER ASSIGNED (ORIGINAL EVENT CODE: ASPN); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

Free format text: PAYER NUMBER DE-ASSIGNED (ORIGINAL EVENT CODE: RMPN); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

AS Assignment

Owner name: MARIEL THERAPEUTICS, INC., NEW YORK

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:STRYKER CORPORATION;REEL/FRAME:033535/0440

Effective date: 20140630

AS Assignment

Owner name: MARIEL THERAPEUTICS, INC., NEW YORK

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:STRYKER CORPORATION;REEL/FRAME:037460/0806

Effective date: 20140630

Owner name: MARIEL THERAPEUTICS, INC., NEW YORK

Free format text: LIEN;ASSIGNOR:STRYKER CORPORATION;REEL/FRAME:037461/0778

Effective date: 20140630