Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2009 Sep 11.
Published in final edited form as: Endocr Relat Cancer. 2008 Jun 17;15(3):787–799. doi: 10.1677/ERC-08-0079

Re-expression of ABI3BP Suppresses Thyroid Tumor Growth by Promoting Senescence and Inhibiting Invasion

Flavia R M Latini 1, Jefferson P Hemerly 1, Gisele Oler 1, Gregory J Riggins 2, Janete M Cerutti 1
PMCID: PMC2742300  NIHMSID: NIHMS93430  PMID: 18559958

Abstract

Loss of ABI gene family member 3 binding protein (ABI3BP) expression may be functionally involved in the pathogenesis of cancer. Previous reports have indicated a loss of expression in lung cancer and a presumed role in inducing cellular senescence. We show here that ABI3BP expression is significantly decreased in most malignant thyroid tumors of all types. To better understand ABI3BP’s role we created a model by re-expressing ABI3BP in two thyroid cancer cell lines. Re-expression of ABI3BP in thyroid cells resulted in a decrease in transforming activity, cell growth, cell viability, migration, invasion and tumor growth in nude mice. ABI3BP re-expression appears to trigger cellular senescence through the p21 pathway. Additionally, ABI3BP induced formation of HP1γ-positive senescence-associated heterochromatin foci (SAHF) and accumulation of senescence-associated β-galactosidase. The combination of a decrease in cell growth, invasion and other effects upon ABI3BP re-expression in vitro helps explain the large reduction in tumor growth we observed in nude mice. Together, our data provides evidence that the loss of ABI3BP expression could play a functional role in thyroid tumorigenesis. Activation of ABI3BP or its pathway may represent a possible basis for targeted therapy of certain cancers.

Keywords: TARSH, ABI3BP, thyroid carcinoma, senescence, invasion and migration

Introduction

We have previously identified biomarkers that distinguish malignant follicular thyroid carcinoma (FTC) from benign follicular thyroid adenoma (FTA) with high sensitivity and specificity (Cerutti J. M. et al., 2004). These four genes also help distinguish malignant tumors in a wide range of thyroid tumors (Cerutti J. M. et al., 2006). The expression studies, performed originally to locate clinical markers, also revealed genes expressed in non-malignant tissues (normal thyroid and FTA), but not expressed or expressed at lower levels in the malignant FTC. One of these genes, ABI3BP, formerly named TARSH, was of particular interest because it was expressed in nearly all FTAs and normal thyroid samples, with consistent down-regulation in all FTCs (Cerutti J. M. et al., 2004).

Although the biology of ABI3BP (ABI3 binding protein) is largely unknown, it has been suggested that ABI3BP interacts with a SH3 domain in ABI3 (Abl-interactor member 3) (Matsuda et al., 2001). ABI3, along with the Abl-interactors E3B1/Abi2/Argbp1, belong to the family of cytoplasmic molecular adaptors containing SH3 that interact with Abl-family tyrosine kinases. Although speculative, it seems that members of Abl-interactors family might negatively regulate cell growth and transformation by suppressing certain tyrosine kinase-mediated signaling in mammalian cells (Ichigotani et al., 2002a). Overexpression of these family members was associated with inhibited cell proliferation, reduced transforming potential, and suppression of motility and metastasis dissemination (Ichigotani et al., 2002a, Ichigotani et al., 2002b). These findings suggest that Abl-interactors may act as tumor suppressor molecules. Therefore, if ABI3BP binds to the Abl-interactor ABI3, it is predicted to result in inhibited cell growth. Circumstantial evidence consistent with a function for ABI3BP that suppresses cell proliferation is the report that its expression is greatly reduced in lung cancers and other primary tumors (Terauchi et al., 2006).

In the present study, we sought to determine if loss of ABI3BP expression play a role in thyroid tumorigenesis. We expanded our analysis and investigated the expression of ABI3BP in a larger series of thyroid tumors which includes, in addition to a larger number of FTAs and FTCs, Hürthle cell adenomas, Hürthle cell carcinomas, papillary thyroid carcinomas and normal thyroids. ABI3BP is lost in most of malignant lesions while it is expressed in a large number of benign lesions and normal thyroid tissues. We next explored functionally the effects of ABI3BP re-expression into two thyroid carcinoma cell lines in which ABI3BP expression was lost. Additionally, we suggest a possible pathway in which ABI3BP is involved. Finally, we show that ABI3BP re-expression has an effect on subcutaneous tumors of thyroid origin grown in nude mice.

Materials and Methods

Tissue samples

A total of 79 thyroid tissue specimens obtained from patients undergoing thyroid surgery for thyroid disease at Hospital São Paulo, Federal University of São Paulo, Brazil were used for this study. Samples were frozen immediately after surgical biopsy and stored at −80°C and included 36 benign thyroid lesions (21 follicular thyroid adenomas and 15 Hürthle cell adenomas), 36 malignant thyroid tumors (17 follicular thyroid carcinomas, 6 Hürthle cell carcinomas, and 13 papillary thyroid carcinomas), and 7 normal thyroid tissues. All tissue samples were obtained with informed consent according to established Human Studies Protocols at Federal University of São Paulo. The study of patient materials was conducted according to the principles expressed in the Declaration of Helsinki.

Cell lines

A follicular (WRO) and an undifferentiated (ARO) thyroid carcinoma cell lines were used in this study (generous gifts of Dr. Alfredo Fusco, University Federico II, Naples, Italy). WRO and ARO were grown in DMEM (Invitrogen Corp., Carlsbad, CA) supplemented with 10% FBS (Invitrogen), 100 units/mL of penicillin and 100 μg/mL streptomycin in a humidified incubator containing 5% at CO2 37ºC. ARO and WRO cell lines are known to have a number of specific genetic abnormalities including RAS, p53 and BRAF mutation (Kimura et al., 2003, Ouyang et al., 2002).

RNA extraction, cDNA synthesis and quantitative PCR (qPCR) of ABI3BP in human tissues

Total RNA and cDNA synthesis were performed as previously described (Cerutti J. M. et al., 2004). An aliquot of cDNA was used in a 15μL PCR reaction containing 1X TaqMan universal PCR master mix, 10μmol of each specific primer and FAM-labeled probe for the target gene (ABI3BP) or VIC-labeled probe for reference gene (RS8) (TaqMan®Gene Assays on Demand; Applied Biosystems, Foster City, CA). Quantitative PCR reactions (qPCR) were performed in triplicate and the threshold cycle (Ct), obtained using Applied Biosystems software (Applied Biosystems), was averaged (SD ≤1). Gene expression was calculated as described (Cerutti J. M. et al., 2004).

Plasmids constructs

To obtain the full-length human ABI3BP coding sequence, cDNA was synthesized from RNA isolated from normal thyroid tissue and used as template for PCR amplification using the sense 5′TAAATGCAGCTCCAGGGTTG3′ and antisense 5′CTCCTCCGCAAAGCTATTCA3′ primers. PCR product was purified and cloned into the mammalian expression vector pcDNA3.1 using a directional TOPO expression kit (Invitrogen) according to manufacturer’s recommendations. This DNA construct was sequenced to confirm the sense orientation as described (Guimaraes et al., 2006).

Stable expression in thyroid carcinoma cell lines

To establish cell lines expressing ABI3BP, 10μg of DNA construct was transfected into 5 × 106 WRO and ARO cells by electroporation using a Gene Pulser II (Bio-Rad Laboratories Inc., Hercules, CA). ARO and WRO cells transfected with pcDNA3.1 vector were used as controls. Clones were isolated after 3 weeks of selection with G418 (800μg/mL). At least six G418-resistant clones from each transfection were isolated, expanded, maintained on G418 (400μg/mL), and tested for ABI3BP expression by qPCR. To this end, total RNA extracted from each clone was used for cDNA synthesis as described (Cerutti J. M. et al., 2004). An aliquot of cDNA was used in 20μL PCR reaction containing SYBR Green PCR Master Mix (Applied Biosystems) and 200 nM of each primer for ABI3BP or reference gene (ribosomal protein S8). Primer sequences for ABI3BP and reference gene were as follows: ABI3BP sense 5′TTGCCAAGTCACTGTCCCAAT3′ and antisense 5′GTGGCTGGACAGATTTGAAAAAT3′, yielding a product of 93bp; S8 sense 5′TGAAAGGAAAAAGAATGCCAAAA3′ and antisense 5′ CACTGTCCCGGCCTTGAA 3′, yielding a product of 96bp. qPCR was performed in triplicate and the threshold cycle (Ct), obtained using Applied Biosystems software (Applied Biosystems), was averaged (SD ≤1). Gene expression was normalized to the average of S8. Relative expression was calculated as described (Cerutti J. M. et al., 2004). For each cell line, two independently isolated clones that stably express ABI3BP and two pcDNA3.1 clones were used for further in vitro and in vivo experiments.

Focus formation assay

Five × 106 WRO cells were transfected with 10μg of either pcDNA3.1 or DNA construct coding ABI3BP as described above. After 3 weeks of selection with G418 (800μg/mL), WRO cells were fixed in 10% acetic acid and 10% of methanol, stained with 1% crystal violet, and colonies were counted (Iervolino et al., 2006).

MTT assay

ARO cells were analyzed with the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT) assay. In brief, 2 × 104 ARO cells were seeded in 35-mm plates on day 0. Cell growth was measured daily from day 1 to 5 by adding 0.5 mg/mL of MTT (Sigma-Aldrich, St. Louis, MO) in medium at 37°C for 3 hours. The medium was removed and the purple formazan crystals were dissolved in acid isopropanol at room temperature for 10 minutes. The spectrophotometric absorbance was measured at 560 nm.

Cell viability assay

ARO cells (2 × 104) were seeded in 35-mm plates. Cells were mixed with Guava ViaCount Reagent and allowed to stain for 10 minutes (Guava Technologies, Hayward, CA). The Guava System differentiates viable from nonviable cells by detecting fluorescent signals from two fluorescent DNA-binding dyes: one membrane-permeable dye stains all nucleated cells while the second dye enters cells with compromised membrane integrity, i.e., nonviable cells. Viable cells were quantified using a Guava Personal Analyzer (PCA) flow cytometer (Guava Technologies) following the manufacturer’s specifications. Experiments were performed in quintuplicate.

Quantification of apoptotic cells by annexin-V labeling

ARO cells (2 × 104) were seeded in 35-mm plates. For detection of apoptosis, the cells were double-stained with annexin V and nexin 7-AAD according to the manufacturer’s recommendations (Guava Nexin method; Guava Technologies). Cell-associated fluorescence was analyzed by the Guava PCA flow cytometer (Guava Technologies). Results are expressed as the percentage of apoptotic positive cells. Both early apoptotic (annexin V-positive) and late apoptotic (annexin V- and 7 AAD-positive) cells were included in the analysis. Experiments were performed in quintuplicate.

Cellular senescence

Senescence-associated (SA) β-gal staining was performed as described (Severino et al., 2000). Briefly, ARO cells (2 × 104) were seeded in 35-mm plates. On referred days, cells were washed twice with PBS, fixed for 15 minutes and stained with 1 mg/mL 5-bromo-4-chloro-3-inolyl- b-D-galactosidase (X-gal) in buffer (dimethylformamide, 40 mM citric acid/sodium phosphate pH 6.0, 5 mM potassium ferrocyanide, 5 mM potassium ferricyanide, 150 mM NaCl and 2 mM MgCl2). Cells were incubated at 37°C in 5% CO2 for 18 hours and washed twice with PBS. Cells were examined using a light microscope and counted in 5 optical fields (100X). Data represents mean of an experiment performed in quintuplicate.

Senescence-associated heterochromatic foci (SAHF)

Another feature of senescence cells is formation of senescence-associated heterochromatin foci (SAHF) (Collado et al., 2005, Narita et al., 2003). Formation of such structures coincides with the recruitment of protein complexes containing the heterochromatin 1 binding protein γ (HP1γ). The HP1γ expression was analyzed using immunofluorescence. Cells were plated at a density of 1.7 × 102 cells per well in an 8-well glass slide (Nalge Nunc International, Rochester, NY). At day 5, cells were washed with PBS and fixed in methanol. Plates were blocked using 20% normal goat serum in PBS/Tween-20 and incubated for at least 16 hours at 4ºC with HP1γ primary antibody (1/500; MAB3450; Chemicon, Temecula, CA). Cells were counterstained using DAPI.

Expression of p21, E2F1, MMP-1 and Ki67 by qPCR

Expression analysis was performed at days 3 and 5. Total RNA isolation and cDNA synthesis were performed as described (Cerutti J. M. et al., 2007). An aliquot of cDNA was used in 20μL PCR reaction containing SYBR Green PCR Master Mix (Applied Biosystems) and 200 nM of each primer for target gene or reference gene (ribosomal protein S8). Primer sequences were as follows: p21 sense 5′TGGAGACTCTCAGGGTCGAAA3′ and antisense 5′GGCTTCCTCTTGGAGAAGATCA3′, yielding a product of 90bp; Ki67 sense 5′GTCGACGGTCCCCACTTTC3′ and antisense 5′GACACAACAGGAAGCTGGATACG3′, yielding a product of 92bp; E2F1 sense 5′TTGAGGGCATCCAGCTCATT3′ and antisense 5′CCTGGGTCAACCCCTCAAG3′, yielding a product of 105bp; and MMP-1 sense 5′TGTGGCTCAGTTTGTCCTCACT3′ and antisense 5′GGCAAATCTGGCGTGTAATTTT3′ yielding a product of 90bp.

Protein extraction and western blotting analysis

Protein extraction and western blotting analysis were performed according to standard procedures. Briefly, total protein was isolated from clones expressing ABI3BP and vector-transfected clones using an extraction buffer containing 50 mM Tris HCl (pH 7.4), 100 mmol/L NaCl, 50 mM NaF, 1 mM NaVO4, 0.5 % NP-40 and complete protease inhibitor cocktail (Roche, Mannheim, Germany). The whole cell extract was clarified by centrifugation at 10,000 × g. Protein concentration was estimated with a Bradford assay (Sigma-Aldrich). About 50μg of protein was loaded into pre-cast 4–12% SDS-NuPage Bis-Tris Gel (Invitrogen). After transfer, the membrane was blocked and incubated for at least 16 hours at 4°C with anti-phospho-AKT (pAKT; cat# 9271; dilution 1:400) or anti-phospho-ERK (pERK; cat# 9102; dilution 1:1000) purchased from Cell Signaling (Beverly, MA) or anti-α-tubulin (cat#T9026; dilution 1:1000) purchased from Sigma-Aldrich. After incubation with anti-rabbit or anti-mouse peroxidase conjugated secondary antibodies (DAKO, Glostrup, Denmark, dilution 1:5000) proteins were detected using Super Signal West Pico Chemiluminescent Substrate purchased from Pierce (Rockford, IL).

Cell cycle analysis

ARO cells (2 × 105) were seeded in 35-mm dishes. After synchronization of the cells by serum starvation for 24 hours, cells were replaced with DMEM medium supplemented with 10% FBS for 24 hours. Cells were fixed in 70% ethanol for 1 hour, labeled with Guava Cell Cycle Assay reagent and analyzed using Guava PCA flow cytometer (Guava Technologies) according to manufacturer’s recommendation. Experiments were performed in quintuplicate.

Anchorage-independent growth

Anchorage-independent growth was assessed by a double-layer soft agar assay. Initially, 60-mm dishes were layered with 0.5% agar and 1X complete medium. Subsequently, ARO cells (1.5 × 104) were suspended in 1X complete medium and 0.35% agar and seeded in triplicate over a bottom layer of solidified agar. The dishes were incubated at 37°C in 5% CO2. After 3 weeks, colonies greater than 20μm in diameter were counted. Colony formation rate was calculated as percentage of total seeded cells. Two independent experiments were performed.

Nude mouse xenograft model

Four to five week old male athymic nude (nu/nu) mice were maintained according to the guidelines of the Division of Animal Resources at the Federal University of São Paulo. ARO stable cell clones were suspended in sterile PBS to 2 × 106/200μL and injected subcutaneously into the flank of individual nude mice. Mice were then monitored biweekly during three weeks. If a tumor was present, volume was calculated by the rotational ellipsoid formula: V = A × B2/2 (A = axial diameter; B = rotational diameter). Tumor tissues were collected and were either embedded in paraffin for conventional histology or stored at −80°C. Additionally, we also extracted RNA from formed tumors, performed cDNA synthesis and tested by qPCR ABI3BP, p21 and MMP-1 expressions as described above.

Matrigel invasion assay

Cell invasion was analyzed using BioCoat Matrigel Invasion Chamber according to the manufacturer’s recommendation (Becton Dickinson, Bedford, MA). FBS was used as chemoattractant. WRO cell clones were added to the invasion or control chamber at a density of 2.5 × 104 and, after 24 hours, cells remaining above the insert membrane were removed by gentle scraping with a sterile cotton swab. Cells that had invaded through the Matrigel to the bottom of the insert were fixed, stained in rapid panoptic LB (Laborclin, Brazil) and mounted. Cells were examined using a light microscope and counted in 3 optical fields (100X). All of the experimental and control groups were done in triplicate. The percentage of invasion cells was determined as the mean of cells invading through Matrigel insert membrane/mean of cell migrating through control insert membrane X100.

Migration assay

To assess cell migration, WRO stable cell clones were suspended in 10mL of DMEM supplemented with 10% FBS, seeded onto 0.75% agar base coated plates prepared in DMEM and cultured until spheroids were formed. At least 12 spheroids of similar diameter were placed in the middle of uncoated 24-well plates. The area covered by cells spreading out from the spheroid was measured at the beginning of the experiment and daily for an observation period of 6 days. The areas of spheroids were calculated as described (Vajkoczy et al., 2006).

Statistical analysis

The qPCR values were log transformed and submitted to Student’s t test (unpaired). In vitro results were log transformed and submitted to Student’s t test (paired). In vivo results were submitted to Wilcoxon test. Were declared significant the results with P <0.05.

Results

ABI3BP is under-expressed in malignant thyroid lesions

Among the genes we previously analyzed as underexpressed in follicular thyroid carcinomas, ABI3BP stood out because of its consistent loss in malignant follicular tumors (Cerutti J. M. et al., 2004). We extended our previous analysis by also including Hürthle cell carcinomas, papillary thyroid carcinomas and the benign Hürthle cell adenomas in our assay. As demonstrated by qPCR, ABI3BP expression was either reduced or absent in most thyroid carcinomas (follicular thyroid carcinomas, Hürthle cell carcinomas and papillary thyroid carcinomas), when compared to normal thyroid and most of benign lesions (follicular thyroid adenomas and Hürthle cell adenomas; P=0.0001; Fig 1A). Surprisingly ABI3BP was up regulated in few adenomas, compared to normal samples. Although samples were not matched to one another, it may suggest that these pre-malignant lesions may express ABI3BP as a mechanism to prevent proliferation of cells at risk for neoplastic transformation. Additionally, ABI3BP was consistently under expressed in thyroid carcinomas. Therefore, we hypothesized that ABI3BP is functionally involved in suppressing either thyroid tumor growth or tumor progression.

Figure 1.

Figure 1

Open in a new tab

Relative expression levels of ABI3BP in thyroid tumors and cell lines and its ability to decrease foci formation. In A, symbols correspond to the relative expression values for ABI3BP in normal thyroid tissues (NT; n=7■), follicular thyroid adenomas (FTA; n=21▲), Hürthle cell adenomas (HCA; n=15▼;), follicular thyroid carcinomas (FTC; n=17◆), Hürthle cell carcinomas (HCC; n=6•) and papillary thyroid carcinomas (PTC; n=13□). The qPCR values were log transformed before application of statistical test (P=0.0001). In B, qPCR analysis of stably transfected clones selected for the in vitro and in vivo experiments. The analysis demonstrated that ABI3BP expression was induced about 2000-fold in ARO-transfected with a construct encoding ABI3BP when normalized to vector-transfected cells. WRO cells had an average 2-fold increased basal-level expression when transfected with a construct encoding ABI3BP. In C, transforming potential of a construct encoding ABI3BP in WRO cell line compared to a pcDNA3.1 empty vector control. ABI3BP decreased dramatically the transformation ability of WRO cells (0.8 foci/μg of plasmid DNA) compare to control (32.7 foci/μg of plasmid DNA). Black bar corresponds to WRO transfected with control clones and white bar to the cells transected with ABI3BP expression vector. The data represents the mean ± SD of the experiment performed in triplicate.

Re-expression of ABI3BP in thyroid carcinoma cell lines

To explore ABI3BP’s potential pathogenic role, we generated an in vitro thyroid cancer model. As previously demonstrated, ARO thyroid carcinoma cell line do not express ABI3BP. WRO express ABI3BP at very low levels (Cerutti J. M. et al., 2004). A construct expressing ABI3BP and an empty vector were transfected into both cell lines. Several stable clones were obtained from each transfected cell line and qPCR was used to assess levels of ABI3BP. Two representative clones from each group were chosen for our studies. As shown in Fig. 1B, the qPCR data demonstrated that ABI3BP transcripts were induced about 2000-fold in ARO-transfected with a construct encoding ABI3BP. WRO-transfected with a construct encoding ABI3BP had an average 2-fold increase in ABI3BP (Fig 1B). This fold-induction was obtained when ABI3BP expression was normalized to vector-transfected clones (endogenous expression). Importantly, when the clones re-expressing ABI3BP were normalized to the expression observed in normal thyroids, the relative expression observed in ARO-ABI3BP transfected cells was similar to the biological range observed in most normal thyroid and adenomas. The WRO-ABI3BP transfected cells had expression similar to that observed in the few adenomas with greater ABI3BP expression (data not shown). Based on the ability to obtain physiologic levels of ABI3BP in ARO cells, and that the ARO line before transfection has a high tumorigenic potential (Cerutti J. et al., 1996), ARO clones were used in most of the experiments in this work. WRO clones were chosen for migration and invasion assays and foci formation, because ARO does not aggregate into spheroids, does not migrate through Matrigel within 24 hours and it was difficult to measure foci formation as ARO has a high growth rate.

Expression of ABI3BP reduces colony formation in thyroid cancer cells

To see if ABI3BP could inhibit foci formation, the vector only or the expression construct encoding ABI3BP was transfected into the WRO cell line. When WRO was transfected with a vector containing wild-type human ABI3BP, the number of colonies was significantly reduced (0.8 foci/μg of plasmid DNA) when compared to the number observed with control vector (32.7 foci/μg of plasmid DNA; P< 0.05; Fig. 1C). This significant reduction in the number of colonies suggests that ABI3BP reduces the malignant potential of the WRO cells.

Expression of ABI3BP inhibits cell growth

To determine if ABI3BP re-expression decreases proliferation, the stably transfected clones were compared to controls by a MTT assay. As showed in Fig. 2A, ABI3BP was able to significantly suppress the growth of ARO cells in comparison with the cells transfected with empty vector (P<0.05).

Figure 2.

Figure 2

Open in a new tab

Effect of ABI3BP re-expression on proliferation, viability, apoptosis and senescence in ARO thyroid carcinoma cells. Black bars correspond to control clones (n=2) and white bars correspond to ABI3BP expressing clones (n=2). In A, is shown the effect of ABI3BP expression on proliferation suppression in the ARO cell line, detected by an MTT assay. The data represents the mean ± SD of absorbance at 560 nm of at least two experiments performed in triplicates on each of five days. In B, the mean of percentage ± SD of viable cells shows a decrease with ABI3BP expression. The decrease with ABI3BP was 5% at day 3 and 10% at day 5. In C, Guava Nexin assay is represented by the mean ± SD of the percentage of apoptotic cells from quintuplicate. The percentage of apoptotic cells was higher in cells expressing ABI3BP compared to control cells (3% at day 3 and 1% at day 5). In D, representative results illustrate increased senescence-associated β-galactosidase (SA-β-gal) staining with ABI3BP expression on days 3 and 5. In E, the SA- β-gal staining is represented by the mean ± SD of the percentage of β-galactosidase positive cells from quintuplicate experiments. The percentage of β-galactosidase positive cells was higher in ARO cells expressing ABI3BP. In F, representative results of immunofluorescence for HP1γ, which demonstrated that enforced expression of was sufficient to induce SAHF.

Effect of ABI3BP on cell viability and apoptosis

To ascertain if re-expression of ABI3BP would decrease thyroid cancer cell’s viability, the Guava ViaCount Reagent was used. The Guava ViaCount reagent contains two fluorescent dyes, one cell permeable and one impermeable to cells with an intact plasma membrane. As determined by ViaCount, re-expression of ABI3BP led to a lower percentage of viable cells (P<0.05; Fig. 2B). This finding suggests that re-expression of ABI3BP might induce apoptosis. To quantify the apoptotic rate of ARO cells expressing ABI3BP, we analyzed annexin-V binding using a Guava Nexin kit, which reveals phosphatidylserine externalization in apoptotic cells. Re-expression of ABI3BP led to a moderate increase of apoptosis (Fig. 2C), which suggest that another mechanism may also be involved in inhibition of cell growth and decrease of cell viability. Since ABI3BP was previously associated with senescence process (Uekawa et al., 2005) and it was previously suggested that senescence may interfere with cell membrane integrity (Xin et al., 2003), a percentage of nonviable cells observed may represent senescent cells.

ABI3BP expression induces senescence in ARO cells

Senescent cells stain positive for SA-β-gal and a distinct heterochromatic structure designed as senescence associated heterochromatin formation (SAHF). We first observed that SA-β-Gal positive cells, indicated by blue staining, were increased when ABI3BP is re-expressed (Fig. 2D, E). Secondly, immunofluorescence of HP1γ showed an expression pattern concentrated in DNA foci of cells expressing ABI3BP compared to controls which suggested that the re-expression of ABI3BP was associated with the nuclear changes that occur during senescence. Conversely in vector-transfected cells, the staining for HP1γ gave a weak signal and it was disperse through the nucleoplasm (Fig. 2F).

ABI3BP reduces expression of the proliferation marker Ki67 in ARO cells

As aforementioned, ABI3BP significantly suppress the growth of ARO cells. In order to measure cell proliferation, beyond the MTT test, expression levels of the proliferation marker Ki67 were tested at days 3 and 5. As measured by Ki67 expression, a lower proliferation rate was observed in ARO re-expressing ABI3BP when compared to control cells (Fig. 3A).

Figure 3.

Figure 3

Open in a new tab

Expression of proliferation and senescence-associated markers following re-expression of ABI3BP. Black bars correspond to control clones (n=2) and white bars correspond to ABI3BP expressing clones (n=2). In A, graphs show mean ± SD of Ki67, p21, E2F1 and MMP-1 relative expression levels on days 3 and 5. A decrease of Ki67 and E2F1 and an increase p21 and MMP-1 mRNA was observed following ABI3BP re-expression, mainly at day 5 when senescence was more evident. In B, whole-cell lysates (50μg) of ARO ABI3BP re-expressing versus control cells were analyzed for the phospho-ERK (pERK) and phospho-AKT (pAKT). ABI3BP re-expression was associated with slight decreased pERK at days 3 and 5. A significant increase of pAKT was observed at day five. As a protein loading control, we analyzed α-tubulin.

ABI3BP induces senescence markers in ARO cells

We have shown that ARO cells undergo senescence process following ABI3BP re-expression, although the underlie mechanism is still unclear. Several genes/pathways were associated with senescence process and elucidation of the pathway that control senescence is complex. To start to build a model, we here investigate the potential role of a number of previously identified senescence markers (p21, E2F1 and MMP-1) (Brown et al., 1997, Collado & Serrano, 2006, Collado et al., 2000, Narita et al., 2003, Park et al., 2006). We used qPCR to quantify mRNA levels of tested markers at days 3 and 5, a time that cells re-expressing ABI3BP became positive for SA-β-Gal staining, have decreased expression of proliferation marker and nuclei were positive for HP1γ. At day 5, a time in which senescence process was more evident, p21 mRNA levels were 3-fold increased in ARO cells following ABI3BP re-expression (P<0.05; Fig. 3A). The expression of MMP-1 was significantly increased at days 3 and 5 (P<0.001; Fig. 3A). On the other hand, E2F1 mRNA levels were reduced in ARO expressing ABI3BP (Fig. 3A). Of note, E2F1-responsive genes were stably repressed in senescent cells. It was demonstrated that HP1γ mediate SAHF formation and E2F gene silencing occurs during senescence (Narita et al., 2003).

ABI3BP re-expression alters AKT and ERK phosphorilation

The effect of ABI3BP re-expression was further substantiated by investigation of AKT and ERK signaling pathways. The re-expression of ABI3BP resulted in a slight decreased ERK phosphorylation mainly at day 5 compared with vector-transfected cells. Meanwhile, a significant increase in AKT phosphorylation was observed at day 5 (Fig. 3B).

ABI3BP causes a decrease in cells in S and G2/M

Cell cycle distribution was analyzed by flow cytometry. G0/G1 arrest occurred in ARO cells expressing ABI3BP as indicated by an increase in the percentage number of cells at this phase (Fig. 4A). Although cell cycle was not investigated at day 5, when senescence phenotype was marked observed, the cell proliferation marker Ki67 was down-regulated and the cell cycle inhibitor p21 was up-regulated at day 5 (Fig. 3A). These findings suggest an important growth arrest at day 5.

Figure 4.

Figure 4

Open in a new tab

Effect of ABI3BP re-expression in cell cycle, anchorage-independent cell growth and tumor growth in nude mice. Black bars correspond to control clones (n=2) and white bars correspond to ABI3BP expressing clones (n=2). In A, effect of ABI3BP expressing cells on cell cycle. The percentage of cells and cell cycle distribution is shown using Guava CytoSoft 2.1.4. Cells expressing ABI3BP showed a slight growth arrest when compared with control cells. In B, the graph shows the anchorage independent growth. Although the percentage of colony formation in soft agar is decreased in ARO cells expressing ABI3BP in comparison with control cells, it was not a significant increase. In C, representative animals that received either control cells (animals with tumor formation in the first two panels) or cells expressing ABI3BP (animals with no tumor or smaller tumor in the last two panels). The arrows point to formed tumors. D, tumorigenicity experiments are summarized in the graph showing mean ± SD of the volume of tumors after inoculation of ARO cells. At least 6 animals were inoculated per group. In E, graphs show mean ± SD of ABI3BP, p21 and MMP-1 relative expressions of formed tumor of nude mice. We observe an increased p21 and MMP-1 expressions when ABI3BP was re-expressed

ABI3BP affects anchorage-independent cell growth

We evaluated whether the expression of ABI3BP had an effect on the in vitro transformed phenotype using soft-agar colony-forming assay. Soft-agar growth of ABI3BP transfected cells was reduced when compared to those of control vector-transfected ARO (Fig. 4B).

ABI3BP reduces tumor growth in nude mice

Although the anchorage-independent growth was not reduced at significant levels, other in vitro results encouraged us to investigate whether ABI3BP had potential in reducing tumor formation in nude mice. ARO cells expressing ABI3BP did not form tumors in nude mice (n=2) or formed a very small tumor (0.11 ± 0.6cm3; n=4). In contrast, control mice had extensive tumors (3.62 ± 2.84 cm3; n=8; Fig. 4C). Interestingly, in one control mouse, a marked tumor vascularization was observed. Therefore, a significant decrease in tumor formation, represented as mean of tumor volume, is demonstrated in mice with cells expressing ABI3BP when compared with controls (P=0.027; Fig. 4D). When presented, an aliquot of tumor was stored at −80ºC and a fraction was processed for routine histology and immunohistochemical analysis. H&E staining revealed the presence of tumors within the flank of 100% of controls. Neither lung nor lymph node metastases were found in any mice.

Senescence markers on tumor growth in nude mice

Since we observed an increased expression of senescence markers in cells re-expressing ABI3BP, they were also investigated in tumor samples that were taken from tumors growing on the flanks of nude mice. The expression of p21, MMP-1 and ABI3BP was assayed by qPCR. A higher expression of p21 and MMP-1 were detected in tumors formed after injection of cells expressing ABI3BP compared to tumors formed upon injection of control cells (Fig. 4E). These findings corroborate with our in vitro analysis and suggest that ABI3BP induces senescence-like growth arrest through modulation of the p21 pathway.

ABI3BP inhibited invasion and migration of WRO cells

Given these in vivo and in vitro findings, we sought to determine invasion and migration potential of cells expressing ABI3BP. Cellular invasiveness was quantified using BioCoat Matrigel Invasion Chamber. WRO cells expressing ABI3BP significantly attenuated cellular invasiveness (30.92%) when compared with cells transfected with empty vector (62.86%; Fig. 5A, B). The migration ability was demonstrated by a spheroid growth assay. We observed the reduction in spheroid area in ABI3BP-expressing cells. A more significant effect on migration was observed in WRO cells expressing ABI3BP at day 6 compared with control (Fig. 5C).

Figure 5.

Figure 5

Open in a new tab

The effect on invasion and migration following ABI3BP re-expression in the WRO cell line. Black bars correspond to control clones (n=2) and white bars correspond to ABI3BP expressing clones (n=2). A, representative results of invading cells are shown with a 100X magnification. Cells expressing ABI3BP decreased the percentage of invasion. B, the percentage of invasive cells in a Matrigel assay is shown. The mean ± SD of the percentage of triplicates are shown. C, cell migration was assessed by plating tumor spheroids and measuring the area covered by tumor cells migrating from the originating spheroid over time. The graphs display the mean ± SD of at least 12 spheroids of each clone. Tumor cell migration was impaired in cells expressing ABI3BP after the second day.

Discussion

Our previous work suggested a consistent loss of ABI3BP expression in malignant follicular thyroid carcinoma (Cerutti J. M. et al., 2004). In this study, we expanded our analysis of follicular thyroid tumors and also included other thyroid tumors subtypes. ABI3BP expression was either reduced or absent not just in FTCs, but in most malignant lesions and thyroid carcinoma cell lines compared with benign lesions and normal thyroid tissues. Therefore, loss of ABI3BP expression is not restricted to a specific malignant histological subtype. Recently, others have showed that ABI3BP expression was significantly decreased in several tumor types when compared to the expression in corresponding non-neoplastic tissue specimens (Terauchi et al., 2006). This expression pattern hints that ABI3BP might play a role in maintaining a normal phenotype in several types of cancer.

We next sought to determine if ABI3BP was functionally involved in thyroid malignancy. We tested the effects of re-expression of ABI3BP on thyroid carcinoma cells in vitro and in vivo. Several lines of evidence from this research support the hypothesis that ABI3BP reduces tumor growth and progression.

We first demonstrated that the ectopic expression of ABI3BP inhibits foci formation and reduces cellular proliferation and viability. Furthermore, the results show that ABI3BP markedly affected tumor growth in vivo. Since growth inhibitory effects may be caused by the re-establishment of programmed cell death, we next investigated the role of ABI3BP in apoptosis. Although forced ABI3BP expression increased apoptosis, the small percentage of apoptotic cells could not fully explain the larger reduction on cell proliferation and viability. Another mechanism that controls cell proliferation and restricts tumor growth is cellular senescence.

Since senescent cells may remain viable, one could argue that senescence could not be the mechanism by which ABI3BP reduces proliferation and tumor growth. However, it is important to note that oxidative stress, observed during senescence process, may interfere with cell membrane integrity (Xin et al., 2003). Therefore, a proportion of non-viable cells observed upon ABI3BP re-expression may represent senescent cells that have lost membrane integrity and were detected because they were permeable to the dye.

There are additional evidences suggesting that ABI3BP could potentially induce senescence. Several groups detected the occurrence of senescence in premalignant tumor whereas cells in malignant tumors are unable to trigger senescence (Chen et al., 2005, Collado et al., 2005, Michaloglou et al., 2005). Therefore, they conclude that senescence worked as a barrier to prevent progression of cells that are at risk for tumorigenic transformation (Chen et al., 2005, Collado & Serrano, 2006).

Given that ABI3BP expression is lost in thyroid malignancies and that others implicate the murine homologue (mABI3BP) in stress-induced senescence in mouse embryonic fibroblasts (Uekawa et al., 2005), we investigated whether senescence could be an additional growth inhibitory mechanism for ABI3BP expression.

We infer from our findings that ABI3BP induces cellular senescence, suggesting that senescence might be the preferential mechanism associated with growth inhibitory effect observed in cells expressing ABI3BP. It is an important aspect because prevention of tumor progression can be done either by inducing apoptosis or senescence (Collado & Serrano, 2006). Since cellular senescence is an important tumor suppression process, the characterization of genetic pathways to senescence is needed.

It has been observed that various forms of stress including DNA-damaging agents, oncogenic activation, oxidative stress and inadequate culture conditions induce a state that is indistinguishable from replicative senescence which was called premature senescence or stress-induced senescence (Campisi, 2001, Lowe et al., 2004, Serrano & Blasco, 2001). Although the molecular mechanism underlying the senescence process remains poorly understood, recent studies have provided mechanistic insights into the senescence process. There is no doubt that constitutively active mutants of RAS/RAF provoke premature senescence in vivo and in vitro, additional alteration may be necessary to maintain an irreversible state of growth arrest. Investigation of the signaling pathways showed that inactivation of one of the effectors of the p53 or RB pathways is required to bypass senescence (Itahana et al., 2001, Mason et al., 2004, Michaloglou et al., 2005, Narita et al., 2003). How p53 and RB induce senescence is not completely understood and may be cell type and context-dependent. As suggest by recent report, RB contributes to senescence by promoting senesce-associated heterochromatin foci (SAHF) and by silencing E2F targets genes (Itahana et al., 2001, Narita et al., 2003).

Although reliable, molecular markers for the senescent state are still missing, some characteristics such as senescence-associated β-galactosidase (SA-β-gal) activity, Ki67 down-regulation, expression of cell cycle inhibitors such as p21 and chromatin remodeling have proven useful as indicators of cellular senescence (Braig & Schmitt, 2006). Therefore, the investigation of these senescence-associated phenotypes will help to clarify the role of ABI3BP.

ARO cell line exhibits a number of specific genetic changes that may be a mechanism of tumor cells to evade senescence, including BRAF V600E and p53 mutation (Fagin et al., 1993, Kimura et al., 2003). Interestingly, when the ARO cell line was stably transfected with wild-type p53, effects similar to those seen when we re-expressed ABI3BP were observed (Nagayama et al., 2000). Whether the re-expression of ABI3BP induces senescence by restoring p53 pathway and/or interfering with RAS/RAF/MAPK/ERK pathway may lead to a better and novel understanding on how ABI3BP induces senescence.

A rational approach would be investigating the level of expression of p21, which is downstream of p53 and appears to be essential for induction of senescence (Itahana et al., 2001). We here demonstrated that p21 mRNA was up-regulated following ABI3BP re-expression compared to control cells, in both in vitro and in vivo analysis. Although the mechanism that underlies the p21 induction is unknow, ectopic expression of ABI3BP induces changes in gene expression that resemble the gene expression changes that occur in senescent cell.

Since several other proteins have been implicated in this complex process, a question that immediately comes to our minds is: what other proteins may be involved in senescence process induced by ABI3BP?

It was demonstrated that constitutive activation of AKT promotes senescence-like growth arrest via p21-dependent pathway (Miyauchi et al., 2004). Recently, it was demonstrated that AKT-dependent inactivation of FOXO3a induced many senescence phenotypes such as SA-β-Gal staining and up-regulation of p53 and p21 (Kyoung Kim et al., 2005). Additionally, it has been suggested that AKT participates in the regulation of both p53-dependent and p53-independent p21 expression (Mitsuuchi et al., 2000). A markedly increased expression of pAKT was observed in ARO cells re-expressing ABI3BP, mainly at day 5 when most of senescence-associated phenotype was observed, such as SA-β-Gal staining, senescence-associated heterochromatin foci formation (SAHF), p21 overexpression, Ki67 down-regulation and in vitro and in vivo growth inhibition.

E2F1 is among the growth regulatory genes that are repressed during senescence (Dimri et al., 1994), although this is controversial (Dimri et al., 2000, Park et al., 2006). The contradictory activities of E2F1 may be due to cell context. We here demonstrated that E2F1 was underexpressed in cells re-expressing ABI3BP when compared to controls. This result corroborates with previous findings in which lower E2F1 expression was associated with a favorable prognosis in breast cancer (Vuaroqueaux et al., 2007) and a higher E2F1 expression was found in papillary and anaplastic thyroid cancers (Onda et al., 2004).

Regarding the RAS/RAF/MAPK/ERK pathways, it has been suggested that RAF-induced senescence appears to have no obvious requirement for either p53 or p21 (Zhu et al., 1998). Although we have found a slight decrease in pERK, our findings suggest that it may occur through independent mechanism.

However, the senescence phenotype is not only mainly characterized by irreversible arrest of cell division and gene expression changes aforementioned. Senescent cells also express genes that have no obvious direct role in cell proliferation but are associated with remodeling. For example, cells may develop a constitutive matrix-degrading phenotype by secreting large amounts of matrix metalloproteinases such MMP-1 (interstitial collagenase) (Collado & Serrano, 2006, Linskens et al., 1995). We here found an increased expression of MMP-1 in ARO cells re-expressing ABI3BP compared to control cells in both in vivo and in vitro.

Furthermore, besides its role in growth suppression and the determination of some components of the signaling pathways through which ABI3BP induces senescence, we here investigated the role of ABI3BP in invasion and migration. In this report, we show that ABI3BP significantly reduces spheroid growth and the percentage of invading cells in Matrigel. These findings, together with the in vivo results, strongly suggest that ABI3BP impairs migration and invasive ability of thyroid carcinoma cell line.

It is worth noting that ABI3BP was described to be an ABI3-binding protein, as it was isolated from a human placenta cDNA library using the SH3 domain of human ABI3, formerly named NESH (Matsuda et al., 2001). ABI3 is an adaptor protein that, through the SH3 domain, interacts with Abl-family tyrosine kinases and suppresses the transforming activity in mammalian cells. It was also suggested that the loss of ABI3 expression could be involved in the mechanism of cell motility and metastasis (Ichigotani et al., 2002b). One can postulate that ABI3BP may interact with ABI3 or other abl-interactor to regulate actin cytoskeleton (Hirao et al., 2006, Ichigotani et al., 2002b). However, the mechanism by which ABI3BP inhibits migration and invasion remains to be understood.

The mechanism by which ABI3BP is under expressed is unknown. PCR amplification and karyotype analysis did not detect loss of heterozygosis at 3q12 where ABI3BP is located (data not shown). Methylation analysis of the region could find an epigenetic alteration responsible for its expression loss, although using the CpG plot program, we did not find CpG islands in the promoter region of ABI3BP (www.ebi.ac.uk/emboss/cpgplot). Another likely explanation is that an activated tyrosine kinase could lead to down-regulation of ABI3BP, as usually occurs with Abl-interactors (Ichigotani et al., 2002b).

Interestingly, we previous identified five isoforms of ABI3BP in thyroid tissues, most of them expressed in normal thyroid tissues and not expressed in malignant lesions (Guimaraes et al., 2006). One specific isoform, an insertion of 265 bp in intron 24, which generates a premature stop codon, was found only in FTC. These findings suggest that alternative splicing could be a mechanism responsible for ABI3BP loss of expression. Interestingly, alternative splicing of ABI3BP was also described in murine (Uekawa et al., 2005).

Based on our findings we suggest that ABI3BP inhibits cell growth, reduces cell viability, promotes senescence, and decreases migration and invasion in vitro. All these features are consistent with the fact that ABI3BP behaves to reduce tumor growth when re-expressed in thyroid cancer cells.

Of note, many of chemotherapeutic agents used in clinical are assumed to exert their anti-tumor effect through induction of apoptosis. Since ABI3BP may act to suppress growth in thyroid and possibly other tumor types, understanding its molecular mechanism of suppression is of great interest. The possibility is raised if increasing ABI3BP expression levels through pharmacological or other means may be useful to inhibit malignant growth and invasion. Chemotherapy-induced premature senescence could represent an alternative approach to treat tumors that are resistant to conventional therapies.

Acknowledgments

This project was supported by NIH Grant CA113461, and the São Paulo State Research Foundation (FAPESP) from grants 04/15288-0 and 05/60330-8. JMC is investigator of the Brazilian Research Council (CNPq), FRML and GO are scholars from FAPESP and GJR is the recipient of the Irving J. Sherman M.D. Research Professorship.

Footnotes

Conflict of interest: The authors declare that they have no affiliations that would constitute a financial conflict of interest relating to the subject matter of this study.

References

  1. Braig M, Schmitt CA. Oncogene-induced senescence: putting the brakes on tumor development. Cancer Res. 2006;66:2881–2884. doi: 10.1158/0008-5472.CAN-05-4006. [DOI] [PubMed] [Google Scholar]
  2. Brown JP, Wei W, Sedivy JM. Bypass of senescence after disruption of p21CIP1/WAF1 gene in normal diploid human fibroblasts. Science. 1997;277:831–834. doi: 10.1126/science.277.5327.831. [DOI] [PubMed] [Google Scholar]
  3. Campisi J. Cellular senescence as a tumor-suppressor mechanism. Trends Cell Biol. 2001;11:S27–31. doi: 10.1016/s0962-8924(01)02151-1. [DOI] [PubMed] [Google Scholar]
  4. Cerutti J, Trapasso F, Battaglia C, Zhang L, Martelli ML, Visconti R, Berlingieri MT, Fagin JA, Santoro M, Fusco A. Block of c-myc expression by antisense oligonucleotides inhibits proliferation of human thyroid carcinoma cell lines. Clin Cancer Res. 1996;2:119–126. [PubMed] [Google Scholar]
  5. Cerutti JM, Oler G, Michaluart P, Jr, Delcelo R, Beaty RM, Shoemaker J, Riggins GJ. Molecular profiling of matched samples identifies biomarkers of papillary thyroid carcinoma lymph node metastasis. Cancer Res. 2007;67:7885–7892. doi: 10.1158/0008-5472.CAN-06-4771. [DOI] [PubMed] [Google Scholar]
  6. Cerutti JM, Delcelo R, Amadei MJ, Nakabashi C, Maciel RM, Peterson B, Shoemaker J, Riggins GJ. A preoperative diagnostic test that distinguishes benign from malignant thyroid carcinoma based on gene expression. J Clin Invest. 2004;113:1234–1242. doi: 10.1172/JCI19617. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cerutti JM, Latini FR, Nakabashi C, Delcelo R, Andrade VP, Amadei MJ, Maciel RM, Hojaij FC, Hollis D, Shoemaker J, et al. Diagnosis of suspicious thyroid nodules using four protein biomarkers. Clin Cancer Res. 2006;12:3311–3318. doi: 10.1158/1078-0432.CCR-05-2226. [DOI] [PubMed] [Google Scholar]
  8. Chen Z, Trotman LC, Shaffer D, Lin HK, Dotan ZA, Niki M, Koutcher JA, Scher HI, Ludwig T, Gerald W, et al. Crucial role of p53-dependent cellular senescence in suppression of Pten-deficient tumorigenesis. Nature. 2005;436:725–730. doi: 10.1038/nature03918. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Collado M, Serrano M. The power and the promise of oncogene-induced senescence markers. Nat Rev Cancer. 2006;6:472–476. doi: 10.1038/nrc1884. [DOI] [PubMed] [Google Scholar]
  10. Collado M, Medema RH, Garcia-Cao I, Dubuisson ML, Barradas M, Glassford J, Rivas C, Burgering BM, Serrano M, Lam EW. Inhibition of the phosphoinositide 3-kinase pathway induces a senescence-like arrest mediated by p27Kip1. J Biol Chem. 2000;275:21960–21968. doi: 10.1074/jbc.M000759200. [DOI] [PubMed] [Google Scholar]
  11. Collado M, Gil J, Efeyan A, Guerra C, Schuhmacher AJ, Barradas M, Benguria A, Zaballos A, Flores JM, Barbacid M, et al. Tumour biology: senescence in premalignant tumours. Nature. 2005;436:642. doi: 10.1038/436642a. [DOI] [PubMed] [Google Scholar]
  12. Dimri GP, Hara E, Campisi J. Regulation of two E2F-related genes in presenescent and senescent human fibroblasts. J Biol Chem. 1994;269:16180–16186. [PubMed] [Google Scholar]
  13. Dimri GP, Itahana K, Acosta M, Campisi J. Regulation of a senescence checkpoint response by the E2F1 transcription factor and p14(ARF) tumor suppressor. Mol Cell Biol. 2000;20:273–285. doi: 10.1128/mcb.20.1.273-285.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Fagin JA, Matsuo K, Karmakar A, Chen DL, Tang SH, Koeffler HP. High prevalence of mutations of the p53 gene in poorly differentiated human thyroid carcinomas. J Clin Invest. 1993;91:179–184. doi: 10.1172/JCI116168. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Guimaraes GS, Latini FR, Camacho CP, Maciel RM, Dias-Neto E, Cerutti JM. Identification of candidates for tumor-specific alternative splicing in the thyroid. Genes Chromosomes Cancer. 2006;45:540–553. doi: 10.1002/gcc.20316. [DOI] [PubMed] [Google Scholar]
  16. Hirao N, Sato S, Gotoh T, Maruoka M, Suzuki J, Matsuda S, Shishido T, Tani K. NESH (Abi-3) is present in the Abi/WAVE complex but does not promote c-Abl-mediated phosphorylation. FEBS Lett. 2006;580:6464–6470. doi: 10.1016/j.febslet.2006.10.065. [DOI] [PubMed] [Google Scholar]
  17. Ichigotani Y, Fujii K, Hamaguchi M, Matsuda S. In search of a function for the E3B1/Abi2/Argbp1/NESH family (Review) Int J Mol Med. 2002a;9:591–595. [PubMed] [Google Scholar]
  18. Ichigotani Y, Yokozaki S, Fukuda Y, Hamaguchi M, Matsuda S. Forced expression of NESH suppresses motility and metastatic dissemination of malignant cells. Cancer Res. 2002b;62:2215–2219. [PubMed] [Google Scholar]
  19. Iervolino A, Iuliano R, Trapasso F, Viglietto G, Melillo RM, Carlomagno F, Santoro M, Fusco A. The receptor-type protein tyrosine phosphatase J antagonizes the biochemical and biological effects of RET-derived oncoproteins. Cancer Res. 2006;66:6280–6287. doi: 10.1158/0008-5472.CAN-06-0228. [DOI] [PubMed] [Google Scholar]
  20. Itahana K, Dimri G, Campisi J. Regulation of cellular senescence by p53. Eur J Biochem. 2001;268:2784–2791. doi: 10.1046/j.1432-1327.2001.02228.x. [DOI] [PubMed] [Google Scholar]
  21. Kimura ET, Nikiforova MN, Zhu Z, Knauf JA, Nikiforov YE, Fagin JA. High prevalence of BRAF mutations in thyroid cancer: genetic evidence for constitutive activation of the RET/PTC-RAS-BRAF signaling pathway in papillary thyroid carcinoma. Cancer Res. 2003;63:1454–1457. [PubMed] [Google Scholar]
  22. Kyoung Kim H, Kyoung Kim Y, Song IH, Baek SH, Lee SR, Hye Kim J, Kim JR. Down-regulation of a forkhead transcription factor, FOXO3a, accelerates cellular senescence in human dermal fibroblasts. J Gerontol A Biol Sci Med Sci. 2005;60:4–9. doi: 10.1093/gerona/60.1.4. [DOI] [PubMed] [Google Scholar]
  23. Linskens MH, Feng J, Andrews WH, Enlow BE, Saati SM, Tonkin LA, Funk WD, Villeponteau B. Cataloging altered gene expression in young and senescent cells using enhanced differential display. Nucleic Acids Res. 1995;23:3244–3251. doi: 10.1093/nar/23.16.3244. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Lowe SW, Cepero E, Evan G. Intrinsic tumour suppression. Nature. 2004;432:307–315. doi: 10.1038/nature03098. [DOI] [PubMed] [Google Scholar]
  25. Mason DX, Jackson TJ, Lin AW. Molecular signature of oncogenic ras-induced senescence. Oncogene. 2004;23:9238–9246. doi: 10.1038/sj.onc.1208172. [DOI] [PubMed] [Google Scholar]
  26. Matsuda S, Iriyama C, Yokozaki S, Ichigotani Y, Shirafuji N, Yamaki K, Hayakawa T, Hamaguchi M. Cloning and sequencing of a novel human gene that encodes a putative target protein of Nesh-SH3. J Hum Genet. 2001;46:483–486. doi: 10.1007/s100380170049. [DOI] [PubMed] [Google Scholar]
  27. Michaloglou C, Vredeveld LC, Soengas MS, Denoyelle C, Kuilman T, van der Horst CM, Majoor DM, Shay JW, Mooi WJ, Peeper DS. BRAFE600-associated senescence-like cell cycle arrest of human naevi. Nature. 2005;436:720–724. doi: 10.1038/nature03890. [DOI] [PubMed] [Google Scholar]
  28. Mitsuuchi Y, Johnson SW, Selvakumaran M, Williams SJ, Hamilton TC, Testa JR. The phosphatidylinositol 3-kinase/AKT signal transduction pathway plays a critical role in the expression of p21WAF1/CIP1/SDI1 induced by cisplatin and paclitaxel. Cancer Res. 2000;60:5390–5394. [PubMed] [Google Scholar]
  29. Miyauchi H, Minamino T, Tateno K, Kunieda T, Toko H, Komuro I. Akt negatively regulates the in vitro lifespan of human endothelial cells via a p53/p21-dependent pathway. Embo J. 2004;23:212–220. doi: 10.1038/sj.emboj.7600045. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Nagayama Y, Yokoi H, Takeda K, Hasegawa M, Nishihara E, Namba H, Yamashita S, Niwa M. Adenovirus-mediated tumor suppressor p53 gene therapy for anaplastic thyroid carcinoma in vitro and in vivo. J Clin Endocrinol Metab. 2000;85:4081–4086. doi: 10.1210/jcem.85.11.6941. [DOI] [PubMed] [Google Scholar]
  31. Narita M, Nunez S, Heard E, Lin AW, Hearn SA, Spector DL, Hannon GJ, Lowe SW. Rb-mediated heterochromatin formation and silencing of E2F target genes during cellular senescence. Cell. 2003;113:703–716. doi: 10.1016/s0092-8674(03)00401-x. [DOI] [PubMed] [Google Scholar]
  32. Onda M, Nagai H, Yoshida A, Miyamoto S, Asaka S, Akaishi J, Takatsu K, Nagahama M, Ito K, Shimizu K, et al. Up-regulation of transcriptional factor E2F1 in papillary and anaplastic thyroid cancers. J Hum Genet. 2004;49:312–318. doi: 10.1007/s10038-004-0146-3. [DOI] [PubMed] [Google Scholar]
  33. Ouyang B, Knauf JA, Ain K, Nacev B, Fagin JA. Mechanisms of aneuploidy in thyroid cancer cell lines and tissues: evidence for mitotic checkpoint dysfunction without mutations in BUB1 and BUBR1. Clin Endocrinol (Oxf) 2002;56:341–350. doi: 10.1046/j.1365-2265.2002.01475.x. [DOI] [PubMed] [Google Scholar]
  34. Park C, Lee I, Kang WK. E2F-1 is a critical modulator of cellular senescence in human cancer. Int J Mol Med. 2006;17:715–720. [PubMed] [Google Scholar]
  35. Serrano M, Blasco MA. Putting the stress on senescence. Curr Opin Cell Biol. 2001;13:748–753. doi: 10.1016/s0955-0674(00)00278-7. [DOI] [PubMed] [Google Scholar]
  36. Severino J, Allen RG, Balin S, Balin A, Cristofalo VJ. Is beta-galactosidase staining a marker of senescence in vitro and in vivo? . Exp Cell Res. 2000;257:162–171. doi: 10.1006/excr.2000.4875. [DOI] [PubMed] [Google Scholar]
  37. Terauchi K, Shimada J, Uekawa N, Yaoi T, Maruyama M, Fushiki S. Cancer-associated loss of TARSH gene expression in human primary lung cancer. J Cancer Res Clin Oncol. 2006;132:28–34. doi: 10.1007/s00432-005-0032-1. [DOI] [PubMed] [Google Scholar]
  38. Uekawa N, Terauchi K, Nishikimi A, Shimada J, Maruyama M. Expression of TARSH gene in MEFs senescence and its potential implication in human lung cancer. Biochem Biophys Res Commun. 2005;329:1031–1038. doi: 10.1016/j.bbrc.2005.02.068. [DOI] [PubMed] [Google Scholar]
  39. Vajkoczy P, Knyazev P, Kunkel A, Capelle HH, Behrndt S, von Tengg-Kobligk H, Kiessling F, Eichelsbacher U, Essig M, Read TA, et al. Dominant-negative inhibition of the Axl receptor tyrosine kinase suppresses brain tumor cell growth and invasion and prolongs survival. Proc Natl Acad Sci U S A. 2006;103:5799–5804. doi: 10.1073/pnas.0510923103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Vuaroqueaux V, Urban P, Labuhn M, Delorenzi M, Wirapati P, Benz CC, Flury R, Dieterich H, Spyratos F, Eppenberger U, et al. Low E2F1 transcript levels are a strong determinant of favorable breast cancer outcome. Breast Cancer Res. 2007;9:R33. doi: 10.1186/bcr1681. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Xin MG, Zhang J, Block ER, Patel JM. Senescence-enhanced oxidative stress is associated with deficiency of mitochondrial cytochrome c oxidase in vascular endothelial cells. Mech Ageing Dev. 2003;124:911–919. doi: 10.1016/s0047-6374(03)00163-5. [DOI] [PubMed] [Google Scholar]
  42. Zhu J, Woods D, McMahon M, Bishop JM. Senescence of human fibroblasts induced by oncogenic Raf. Genes Dev. 1998;12:2997–3007. doi: 10.1101/gad.12.19.2997. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES