Skip to main content
PLOS One logoLink to PLOS One
. 2018 Mar 14;13(3):e0192177. doi: 10.1371/journal.pone.0192177

First true brackish-water nudibranch mollusc provides new insights for phylogeny and biogeography and reveals paedomorphosis-driven evolution

Tatiana Korshunova 1,2, Kennet Lundin 3,4, Klas Malmberg 5, Bernard Picton 6, Alexander Martynov 2,*
Editor: Michael Schubert7
PMCID: PMC5851531  PMID: 29538398

Abstract

A unique example of brackish water fjord-related diversification of a new nudibranch genus and species Bohuslania matsmichaeli gen. n., sp. n. is presented. There are only few previously known brackish-water opisthobranchs and B. matsmichaeli gen. n., sp. n. is the first ever described brackish-water nudibranch with such an extremely limited known geographical range and apparently strict adherence to salinity levels lower than 20 per mille. Up to date the new taxon has been found only in a very restricted area in the Idefjord, bordering Sweden and Norway, but not in any other apparently suitable localities along the Swedish and Norwegian coasts. We also show in this study for the first time the molecular phylogenetic sister relationship between the newly discovered genus Bohuslania and the genus Cuthona. This supports the validity of the family Cuthonidae, which was re-established recently. Furthermore, it contributes to the understanding of the evolutionary patterns and classification of the whole group Nudibranchia. Molecular and morphological data indicate that brackish water speciation was triggered by paedomorphic evolution among aeolidacean nudibranchs at least two times independently. Thus, the present discovery of this new nudibranch genus contributes to several biological fields, including integration of molecular and morphological data as well as phylogenetic and biogeographical patterns.

Introduction

Nudibranchs or sea slugs are an emerging model group in many different fields [14]. The molecular phylogeny of Nudibranchia, and particularly in the case of the aeolidacean nudibranchs is at present an actively debated evolutionary and taxonomic topic [57]. There is a recent suggestion based on a molecular phylogenetic analysis to merge a considerable part of the taxonomic diversity of aeolidacean nudibranchs into the single family Fionidae [8]. However, this suggestion was recently contested and rejected in the frame of a major reassessment of the aeolidacean nudibranchs [9]. The nudibranch molluscs are well known for being almost exclusively marine [1] and in the seas with low salinity (e.g. in the Black and Baltic Seas) their diversity declines considerably [10,11]. To date there are no specific studies which have utilized an integrative molecular and morphological approach to infer patterns of brackish water-related diversification in nudibranchs, but this has been considered in other opisthobranchs [1214].

Habitat shifts are one of the fundamental aspects of biological evolution [1518]. The interaction between Earth’s two major marine and fresh water realms forms a unique narrow, dynamic zone with lower salinity than in the oceans, commonly termed brackish water [19,20]. Such a zone occurs in estuarine areas [21,22] and in other transitory water bodies sometimes with limited exchange of oceanic water, like the Baltic Sea, or the inner part of fjords. Furthermore, since brackish waters repeatedly have been colonized by marine taxa, this often leads to intricate phylogenetic patterns, as has recently been revealed from several metazoan phyla [23,24]. Habitat shifts have played a fundamental role in the evolution of the pulmonate molluscs, which is the largest terrestrial metazoan group after insects and chordates, as they shifted from marine to terrestrial environments also through intermediate stages in intertidal and brackish waters [25].

Here we report a remarkable new genus and species living in a sheltered and stable brackish water environment adjacent to an estuary at the innermost part of the Idefjord, bordering Sweden and Norway. Up to date the new taxon was not found in any other apparently suitable localities on Swedish and Norwegian coasts but only in a very restricted area of the Idefjord. This is in strong contrast to the very few other currently known nudibranch species, which have been recorded from brackish water habitats, but which also have a cosmopolitan broad distribution in different oceans [26]. There are also a few more examples of brackish-water diversification (and even fresh water) in other opisthobranch groups (e.g. acochlidians–see [27]), but among nudibranchs so far, the present finding is the only example of strict adherence to a true brackish water habitat with extremely limited geographical distribution. This highlights the importance of these findings, both for general understanding of the reliability of a separate specific brackish water fauna and for conservational science.

Furthermore, based on integrative molecular and morphological evidence, it is shown that a brackish water-related evolutionary diversification has occurred within different aeolidacean nudibranch clades in parallel, including the newly discovered genus Bohuslania, by underlying paedomorphosis-driven developmental changes (Figs 14). Thus, the discovery of the new unique brackish water taxon in a specific Scandinavian fjord suggests broad implications and it influences our general understanding of the importance of habitat shifts, broad-scale diversification patterns and considerably influences phylogeny and classification of the whole nudibranch group Aeolidacea.

Fig 1. Phylogenetic tree of aeolidacean nudibranchs based on concatenated molecular data (COI + 16S + 28S + H3) represented by Bayesian Inference (BI).

Fig 1

The aeolidacean families are highlighted. The brackish-water living, but non-related taxa Bohuslania gen. n. and Tenellia are indicated as “BW”. Numbers above branches represent posterior probabilities from Bayesian Inference. Numbers below branches indicate bootstrap values for Maximum Likelihood.

Fig 4. Ontogenetic and phylogenetic framework for evidence of parallel paedomorphosis driven-evolution within the brackish-water nudibranchs of the families Cuthonidae (Bohuslania gen. n.) and Trinchesiidae (Tenellia adspersa).

Fig 4

Adults (14 and 20 mm) of marine species Cuthona nana and C. divae respectively, considerably differ from adults of brackish-water Bohuslania matsmichaeli gen. n., sp. n., whereas juveniles of C. nana (6 mm length) and C. divae (5 mm length) are similar to the adult of B. matsmichaeli (10 mm length) by presence of only 3–4 anterior ceratal rows and absence of numerous pre-rhinophoral digestive gland branches. Because Bohuslania, compared to Cuthona, does not develop further to reach the stage with numerous anterior ceratal rows, this stage is considered missing in Bohuslania (indicated by “X” on the scheme) due to heterochronic developmental shifts leading to the adult paedomorphic external morphology. The brackish-water species Tenellia adspersa (adult, 6 mm length) demonstrates a striking paedomorphic feature in presence of secondary oral veil. However, it belongs to the family Trinchesiidae which is more distantly related to the family Cuthonidae according to the present molecular phylogenetic analysis (Figs 1 and 2). Since the appearance of the small oral veil occurs in earlier ontogeny of aeolidacean nudibranchs and predates formation of oral tentacles and numerous anterior ceratal rows, the two stages of development of external features are considered as missing in Tenellia adspersa (indicated by two “X” on the scheme).

Materials and methods

Sample data

A total of seven specimens of the new genus were collected in the Idefjord in Sweden. The outer half of the fjord runs in a southwesterly to northeasterly direction from the fjord opening to the Norwegian city of Halden and the outlet of the Tista river. Here the fjord makes a bend in straight angle and runs in a southeasterly direction, with the Enningdal river estuary at the innermost end. Samples were collected at the midsection of the inner part of the fjord using Scuba diving at 5–7 m depth by Mats Larsson and Michael Lundin in October 2013, March 2014 and September 2015. At this location and depth, the salinity varies from 15 to 18 per mille [28]. Eight species of aeolidacean nudibranchs from several families were collected at Väderö Islands in Sweden, in the North Atlantic near Gulen Dive Resort in Norway, at Banyuls-sur-Mer in France, and in the White Sea and in the Sea of Japan in Russia using Scuba diving. No special permission was needed for collection of nudibranch molluscs in any of these areas. All specimens were deposited in the Gothenburg Natural History Museum (GNM) and the Zoological Museum of Moscow State University (ZMMU).

Morphological analysis

The external and internal morphology was studied under a stereomicroscope and using full frame digital cameras, a Nikon D-810 and a Nikon D300 with Nikon 60mm lens and 2.0 Kenko converter. For the description of internal features, both preserved and fresh specimens (when available) were dissected under the stereomicroscope. The buccal mass of each specimen was extracted and soaked in 10% sodium hypochlorite solution to dissolve connective and muscle tissues, leaving only the radula and the jaws. The features of the jaws of each species where analysed under both stereomicroscope and scanning electron microscope, and then drawn. The coated radulae were examined and photographed using a scanning electron microscope (CamScan). The reproductive systems of the different species were also examined and drawn using the stereomicroscope.

A novel method of non-destructive scanning electron microscopy is applied for the first time to study nudibranch molluscs. The method implies use of the scanning electron microscope but without drying of the studied object. The samples were prepared using the amphiphilic surfactant compound polyoxyethylene sorbitan monolaurate (Tween 20) and by following the method described in [29, 30]. AM and TK have performed the non-destructive SEM study of the reproductive system of Bohuslania matsmichaeli gen. n., sp. n. by using a special dual scanning electron and light microscopy system Keyence VHX-D510, at the National Museum of Nature and Science, Tsukuba, Japan.

Taxon sampling for molecular analysis

For comprehensive aeolidacean taxon sampling twenty one species of the aeolidacean nudibranchs from the genera Abronica, Calma, Cuthona, Cuthonella, Diaphoreolis, Eubranchus, Fiona, Murmania, Phestilla, Tenellia, Tergipes, Zelentia and six outgroup species from the genera Bonisa, Janolus, Samla, Tritonia were used. To analyze the position of the new genus and species Bohuslania matsmichaeli gen. n., sp. n. taxa which previously were included into the genus Cuthona s.l. and related taxa were specifically included.

Currently the genus Cuthona is considerably restricted to only three species [7, 9], two of which, Cuthona nana (Alder & Hancock, 1842) from northern Atlantic and C. divae (Er. Marcus, 1961) from northeastern Pacific were used for the analysis. A third species (Cuthona hermitophila Martynov, Sanamyan & Korshunova, 2015) inhabits the northwestern Pacific (the Sea of Japan) [31,32]. There are molecular data for a Cuthona species from the Russian part of the Sea of Japan in the GenBank [33]. However, we were not able to use these data because the results are misleading. Specifically, the accession number KU133321 which is indicated in [33] as “Cuthona nana from Netherlands” is Human herpesvirus 2 strain G DNA polymerase (UL30) gene. Furthermore, a species which is indicated in [33] as Cuthona nana from the Barents Sea under accession number KU133317 (voucher number ie112) after blast checking turned out to be the completely different taxon Cuthonella concinna. Cuthona nana KU133315 that is claimed to be collected from the Sea of Japan was actually collected in the Barents Sea according to the GenBank voucher number “ie76”. Therefore, we were not able to use such confused data in our analysis and it was impossible to repeat the tree that was presented in [33]. We therefore do not trust any data on “Cuthona” or “Cuthonella” that were sequenced in [33].

To compare the new genus and species with the only previously known brackish water aeolidacean taxon Tenellia adspersa (Nordmann, 1845) it was also included (see Table 1 for full list of samples, localities, and voucher references).

Table 1. List of samples, localities, and voucher references.

Species name Voucher Locality COI 16S H3 28S
Abronica abronia (MacFarland, 1966) CAS181319 California KY128919 KY128716 KY128508 -
Bohuslania matsmichaeli sp.n. ZMMU:Op-600 Sweden, Ide fiord MG323542 MG323548 MG323563 MG323554
Bohuslania matsmichaeli sp.n. ZMMU:Op-601 Sweden, Ide fiord MG323541 MG323547 MG323562 MG323553
Bohuslania matsmichaeli sp.n. GNM9024.1 Sweden, Ide fiord MG323537 - MG323558 -
Bohuslania matsmichaeli sp.n. GNM9024.2 Sweden, Ide fiord MG323538 - MG323559 -
Bohuslania matsmichaeli sp.n. GNM9024.3 Sweden, Ide fiord MG323539 - MG323560 -
Bohuslania matsmichaeli sp.n. GNM9024.4 Sweden, Ide fiord MG323540 - MG323561 -
Bonisa nakaza Gosliner, 1981 CASIZ176146 South Africa HM162746 HM162670 HM162579 -
Calma glaucoides (Alder & Hancock, 1854) ZMMU:Op-603 Norway, Gulen MG323544 MG323550 MG323565 -
Catriona aurantia (Alder & Hancock, 1842) ZMMU:Op-545 Norway, Gulen KY985467 MF523458 MG386404 MF523524
Cuthona divae (Er. Marcus, 1961) CAS174482 California KY128938 KY128733 KY128526 -
Cuthona divae (Er. Marcus, 1961) CAS179464a California KY128940 KY128735 KY128528 -
Cuthona divae (Er. Marcus, 1961) CAS179477 California KY128944 KY128739 KY128532 -
Cuthona nana (Alder & Hancock, 1842) ZMMU:Op-522 Russia, Barents Sea MF523376 MF523397 MF523301 MF523473
Cuthona nana (Alder & Hancock, 1842) GNM9101 Sweden, Gullmar fiord KY128915 KY128708 KY128501 -
Cuthonella cocoachroma (Williams & Gosliner, 1979) CAS179471 California KY128925 KY128720 KY128513 -
Cuthonella cocoachroma (Williams & Gosliner, 1979) CAS185193 California KY128931 KY128726 KY128519 -
Cuthonella concinna (Alder & Hancock, 1843) ZMMU:Op-523 Russia, White Sea MF523377 MF523459 MF523302 MF523525
Cuthonella concinna (Alder & Hancock, 1843) GNM8866 Sweden, Vadero Islands MG323543 MG323549 MG323564 MG323555
Cuthonella hiemalis (Roginskaya, 1987) ZMMU:Op-186 Russia, White Sea MG323545 MG323551 - MG323556
Cuthonella hiemalis (Roginskaya, 1987) WS3439 Russia, White Sea KY129008 KY128800 KY128596 -
Cuthonella soboli Martynov, 1992 ZMMU:Op-524 Russia, Japan Sea MF523378 MF523457 MF523303 MF523523
Cuthonella soboli Martynov, 1992  ZMMU:Op-604 Russia, Japan Sea MG323546 MG323552 MG323566 MG323557
Diaphoreolis lagunae (O'Donoghue, 1926) CAS179465a California KY128956 KY128749 KY128543 -
Diaphoreolis viridis (Forbes, 1840) ZMMU:Op-537 Russia, White Sea MG266028 MG266026 MG266029 MG266027
Eubranchus tricolor Forbes, 1838 ZMMU:Op-525 Norway, Gulen MF523379 MF523399 MF523304 MF523475
Fiona pinnata (Eschscholtz, 1831) MCNCN/ADN51997 Morocco JX087558 JX087492 JX087628 -
Janolus longidentatus Gosliner, 1981 CASIZ176320 South Africa HM162749 HM162673 HM162582 -
Murmania antiqua Martynov, 2006 ZMMU:Op-399 Russia, Kara Sea MF523390 MF523394 MF523315 MF523470
Phestilla lugubris (Bergh, 1870) CAS177437 Philippines KY129075 KY128866 KY128660 -
Phestilla melanobrachia Bergh, 1874 CAS177299 Philippines KY129079 KY128870 KY128664 -
Samla bicolor (Kelaart, 1858) ZMMU:Op-68 Vietnam, Nha Trang MF523383 MF523436 MF523308 MF523503
Samla macassarana (Bergh, 1905) CAS181283 Philippines KY129059 KY128850 KY128644 -
Tenellia adspersa (Nordmann, 1845) CAS184191 New Hampshire KY129085 KY128876 KY128668 -
Tergipes tergipes (Forsskål in Niebuhr, 1775) WS3463 Barents Sea KY129090 KY128881 KY128673 -
Trinchesia caerulea (Montagu, 1804) ZMMU:Op-622 Norway, Gulen MG266024 MG266022 MG266025 MG266023
Tritonia challengeriana Bergh, 1884 CASIZ171177 Bouvet Island HM162718 HM162643 HM162550 -
Tritonia plebeia Johnston, 1828 ZMMU:Op-572 Norway KX788134 KX788122 - KX788132
Zelentia fulgens (MacFarland, 1966) CAS185194 California KY128952 KY128747 KY128540 -
Zelentia ninel Korshunova, Martynov & Picton, 2017 ZMMU:Op-509 Russia, Barents Sea KY952178 MF523400 MF523242 MF523476

Molecular analysis

Small pieces of tissue were used for DNA extraction with Diatom™ DNA Prep 100 kit by Isogene Lab, according to the producer’s protocols. Extracted DNA was used as a template for the amplification of partial sequences of the COI, 16S, H3 and 28S (see Table 2 for the primers). Polymerase chain reaction (PCR) amplifications were carried out in a 20-μL reaction volume, which included 4 μL of 5x Screen Mix (Eurogen Lab), 0.5 μL of each primer (10 μM stock), 1 μL of genomic DNA, and 14 μL of sterile water. The amplification of COI was performed with an initial denaturation for 1 min at 95°C, followed by 35 cycles of 15 sec at 95°C (denaturation), 15 sec at 45°C (annealing temperature), and 30 sec at 72°C, with a final extension of 7 min at 72°C. The 16S amplification began with an initial denaturation for 1 min at 95°C, followed by 40 cycles of 15 sec at 95°C (denaturation), 15 sec at 52°C (annealing temperature), and 30 sec at 72°C, with a final extension of 7 min at 72°C. The amplification of H3 and 28S began with an initial denaturation for 1 min at 95°C, followed by 40 cycles of 15 s at 95°C (denaturation), 15 s at 50°C (annealing temperature) and 30 s at 72°C, with a final extension of 7 min at 72°C. DNA sequences of both strands were obtained using the ABI PRISM® BigDye™ Terminator v. 3.1. on an automated DNA sequencer (Applied Biosystems Prism 3700). Some COI sequences were produced at the Canadian Centre for DNA Barcoding (CCDB), using their automated systems for extraction, PCR and sequencing.

Table 2. Primers.

Name 5′→3′ References
LCO 1490 GGTCAACAAATCATAAAGATATTGG [81]
HCO 2198 TAAACTTCAGGGTGACCAAAAAATCA [81]
16S arL CGCCTGTTTAACAAAAACAT [82]
16S R CCGRTYTGAACTCAGCTCACG [83]
H3 AF ATGGCTCGTACCAAGCAGACGG [84]
H3 AR ATATCCTTGGGCATGATGGTGAC [84]
28S C1 ACCCGCTGAATTTAAGCAT [85]
28S C2 TGAACTCTCTCTTCAAAGTTCTTTTC [86]

A total of 13 specimens were successfully sequenced for the mitochondrial genes cytochrome oxidase subunit I (COI) and 16S rRNA, and the nuclear genes Histone 3 (H3) and 28S rRNA (C1–C2 domain). Of these, COI and H3 from four specimens were sequenced in Gothenburg, the others in Moscow. Additional molecular data for 28 specimens of nudibranchs were obtained from GenBank (see Table 1; all new sequences highlighted in bold). Protein-coding sequences were translated into amino acids for confirmation of the alignment. All sequences were deposited in GenBank (Table 1, highlighted in bold). Original data and publicly available sequences were aligned with the MUSCLE algorithm [34]. Separate analyses were conducted for COI (657 bp), 16S (429 bp), H3 (327 bp) and 28S (337 bp). Gblocks 0.91b [35] was applied to discard poorly aligned regions for the 16S data set (using less stringent options; 10% of the positions were eliminated). An additional analysis was performed with all four concatenated markers (1750 bp). Evolutionary models for each data set were selected using MrModelTest 2.3 [36] under the Akaike information criterion [37]. Two different phylogenetic methods, Bayesian inference (BI) and Maximum Likelihood (ML), were used to infer evolutionary relationships. Bayesian estimation of posterior probability was performed in MrBayes 3.2 [38]. Four Markov chains were sampled at intervals of 1,000 generations. Analysis was started with random starting trees and 107 generations. ML analysis was performed using RAxML 7.2.8 [39] with 1000 bootstrap replicates. Final phylogenetic tree images were rendered in FigTree 1.4.2. Nodes in the phylogenetic trees with Bayesian posterior values ≥0.96% and bootstrap values ≥90% were considered ‘highly’ supported, nodes with 0.90–0.95% and 80–89% accordingly were considered ‘moderately’ supported (lower support values were considered not significant).

To evaluate the genetic distribution of the different haplotypes, a haplotype network for the COI molecular data was reconstructed using Population Analysis with Reticulate Trees (PopART, http://popart.otago.ac.nz) with the TCS network method. The program Mega7 [40] was used to calculate the minimum uncorrected p-distances between all the sequences. Intra- and intergroup genetic distances were also examined.

Additionally, Automatic Barcode Gap Discovery (ABGD) [41] was used to define species. Alignment from the COI marker for Bohuslania, Cuthona, and Tenellia specimens were submitted and processed in ABGD using the Jukes-Cantor (JC69) and Kimura (K80) models and the following settings: a prior for the maximum value of intraspecific divergence between 0.001 and 0.1, 30 recursive steps.

Nomenclatural acts

The electronic edition of this article conforms to the requirements of the amended International Code of Zoological Nomenclature, and hence the new names contained herein are available under that Code from the electronic edition of this article. This published work and the nomenclatural acts it contains have been registered in ZooBank, the online registration system for the ICZN. The ZooBank LSIDs (Life Science Identifiers) can be resolved and the associated information viewed through any standard web browser by appending the LSID to the prefix "http://zoobank.org/". The LSID for this publication is: urn:lsid:zoobank.org:pub:440744B1-789B-441F-BF78-E856182419A5. The electronic edition of this work was published in a journal with an ISSN,and has been archived and is available from the following digital repositories: PubMed Central, LOCKSS.

Results

Molecular phylogenetic relationships between Bohuslania matsmichaeli gen. n., sp. n. and other aeolidacean nudibranchs

The phylogenetic analysis was performed using six specimens of Bohuslania matsmichaeli gen. n., sp. n., twentyone species of aeolidacean nudibranchs (including Cuthona nana, Cuthona divae, several taxa which were until recently included in the genus Cuthona s.l., and several related taxa), and six outgroup specimens. The dataset consisted of one hundred and thirty nucleotide sequences. The combined dataset yielded a sequence alignment of 1750 positions. The GTR + I + G model was chosen for the combined dataset. The resulting concatenated tree (Fig 1) provided better resolution than COI, 16S, 28S or H3 separately. Bayesian Inference (BI) and Maximum Likelihood (ML) analyses based on the combined dataset for the mitochondrial COI and 16S, and the nuclear H3 and 28S genes yielded similar results (Fig 1).

The molecular phylogenetic analysis (Fig 1) supported the presence of a new species, B. matsmichaeli gen. n., sp. n. and inferred its phylogenetic position. All six B. matsmichaeli gen. n., sp. n. clustered together (PP = 1, BS = 100%) in a clade that is sister to the Cuthona clade and was found to be a highly supported lineage (PP = 1, BS = 100%). Cuthona nana and C. divae form two separate sister clades within the Cuthona clade, which is also a highly supported lineage (PP = 1, BS = 100%).

To define species, we use an integrative approach [9, 42] including phylogenetic tree topologies, ABGD analysis, pairwise distances as well as the haplotype network for the COI molecular data reconstructed using the Population Analysis with Reticulate Trees (PopART).

Regarding the supposedly fast-evolving COI marker, genetic distance values within the group Bohuslania gen. n. are 0.3%, within the group Cuthona s.str. are 2.25%, whereas distances between these groups are 9.2%. Intragroup distances within the C. nana group are 1.37%, and within the C. divae group are 1.42% versus intergroup distance of 2.82%. Intergroup distances between B. matsmichaeli gen. n., sp. n. group and the C. nana and C. divae clade are 9.2% and 9.5% respectively.

Minimum uncorrected p-distances of the COI marker which separate the holotype B. matsmichaeli gen. n. sp. n. from C. nana are 9.13% and from C. divae are 9.28%. From the other brackish waters aeolidacean nudibranch Tenellia adspersa there is a high genetic divergence of 18.87%. The ABGD analysis of the COI data set run with two different models revealed four potential species: Bohuslania matsmichaeli sp. n., Cuthona nana, Cuthona divae, and Tenellia adspersa. Results obtained by PopART showed a network of haplotypes that clearly clustered into four groups coincident with B. matsmichaeli gen. n., sp. n., C. nana, C. divae and brackish waters T. adspersa. (Fig 3).

Fig 3. The haplotype network based on cytochrome c oxidase subunit I molecular data showing genetic mutations occurring within family Cuthonidae and brackish-waters aeolidacean nudibranch Tenellia adspersa of the family Trinchesiidae.

Fig 3

The molecular phylogenetic results confirm the morphological analysis data. From the only other genus of the family Cuthonidae, Cuthona Alder & Hancock, 1855, Bohuslania gen. n. is morphologically readily distinguished by absence of the pre-rhinophoral rows of cerata and considerably smaller number of rows of the anterior digestive gland.

Taxonomy

  • Class Gastropoda

  • Order Nudibranchia

  • Family Cuthonidae Odhner, 1934

Diagnosis

Body wide. Notal edges fully reduced. Cerata non-elevated, numerous per row. Ceratal rows branched. Anus acleioproctic or cleioproctic. Radula formula 0.1.0. Central teeth with strong cusp not compressed by adjacent lateral denticles. Vas deferens short, with weak prostate. Supplementary gland present, inserts to unarmed copulative organ.

Included genera

Cuthona Alder & Hancock, 1855, Bohuslania gen. n.

Genus Bohuslania gen. n.

Type species: Bohuslania matsmichaeli gen. n., sp. n.

Urn:lsid:zoobank.org:act: lsid:zoobank.org:act:697C41ED-5B04-4CF2-B4C6-497062EF713D

Diagnosis

Three to four anterior rows of cerata, pre-rhinophoral cerata absent, head broad, oral tentacles placed towards lateral edges of head, no anterior foot corners, anus acleioproctic, jaws with single row of simple denticles, radular teeth narrow with prominent cusp, penis without stylet.

Etymology

After Bohuslän region in southern Sweden, where the only locality of this new genus and species in the Idefjord is known.

Species included

B. matsmichaeli sp. n.

Bohuslania matsmichaeli sp. n.

(Figs 14)

Holotype

Sweden, Idefjord, 59° 02.400' N 11° 24.430'E, inner part of the Idefjord, off beach east of Boråsgården, 7 m depth, 2013-10-8, coll. Mats Larsson and Michael Lundin (ZMMU Op-600, 3 mm in length preserved, 10 mm living length).

Paratypes

Same locality and collectors as holotype, 5–7 m depth, 2013-10-8, 1 specimen (ZMMU Op-601, 3.5 mm in length preserved), 2014-03-26, 1 specimen (ZMMU Op-602, 3 mm in length preserved), 2015-09-18, coll. by Mats Larsson. 4 specimens (GNM Gastropoda 9024:1–4, 3–4 mm length preserved).

Type locality

Idefjord, Bohuslän region.

Etymology

This species is named in honour of Mats Larsson and Michael Lundin, who were the first to discover this unique taxon.

ZooBank registration

lsid:zoobank.org:act:2C02FDDF-E0EF-4DC7-9D28-087BA07696C6.

Description

The length of the preserved holotype is 3 mm (living is 10 mm). The preserved length of 9 mature paratype specimens ranged from 3 to 4 mm. The body is moderately broad (Fig 2A and 2B). The rhinophores are slightly longer than oral tentacles, smooth. The cerata are relatively long, thin and finger-shaped. Pre-rhinophoral cerata absent. Ceratal formula of the holotype: right (4,5,5; Anus,4,3,3,2,2) left (3,4,5; 4,3,2,2). Paratype specimens possess 3–4 pre-anal branches of anterior digestive gland. The head is broad, semicircular, oral tentacles placed towards edges of the head. The foot is moderate, anteriorly rounded, no foot corners.

Fig 2. Morphology of Bohuslania matsmichaeli gen. n., sp. n.

Fig 2

A, Dorsal appearance of the holotype; B. Ventral appearance holotype; C. Living specimen and its egg mass in situ; D, Pharynx and jaws (Paratype GNM 9024); E, Masticatory processes of jaws with denticles; F, Radula, central teeth (Holotype); G, Reproductive system of the holotype (non-destructive SEM with “nano-coating”); H, copulative organ (same technique as in G); I, Scheme of reproductive system. Scales: 10 μm (F, G, H), 500 μm (I). Abbreviations: a–ampulla, fgm–female gland mass, fgo–female opening, hd–hermaphroditic duct, p–penis, pg–penial gland, pr–prostate, ps–penial sheath, rsp–proximal receptaculum seminis, vd–vas deferens, v–vagina.

Colour

The ground colour is semitranslucent sandy yellow with brownish hue (Fig 2A). The digestive branches in the cerata are light yellow to light greenish brown with small darker spots inside. Very fine darker spots of brown pigment are scattered over dorsal part of the body. The ovaries and eggs are visible through the body wall as pale white specks with a faint pink colour. Brightly white small cnidosacs shine through tops of the cerata.

Anatomy

Digestive system. The jaws are ovoid (Fig 2D). The masticatory processes of jaws bear a single row of simple conical denticles (Fig 2E). The radular formula in two studied specimens (5–6 mm preserved in length) is 20–23 x 0.1.0. The radular teeth are almost colourless. The central tooth is moderate, elongated, with prominent cusp and four to seven lateral denticles (Fig 2F).

Reproductive system. (Fig 2G and 2I). The ampulla is moderately large and swollen (Fig 2I, a). The prostate (Fig 2I, pr) is a widened proximal portion of vas deferens (Fig 2I, vd). The vas deferens transits to a penial sheath (Fig 2I, ps), which contains a conical penis without a stylet (Fig 2H and 2I, p). A massive bent supplementary (“penial”) gland inserts into base of the penis (Fig 2I, pg). The proximal receptaculum seminis is large, elongated-oval reservoir, on a stalk (Fig 2I, rsp). The vagina is relatively long and slightly convoluted (Fig 2I, v). The female part includes mucous and capsular glands (Fig 2I, fgm).

Biology

Inhabits mixed environment with stones and mud in shallow (5–7 m) brackish water (15–18 per mille). The athecate hydroid Cordylophora caspia was found in the area and can be a probable food source for B. matsmichaeli. Potentially two techate hydroids could possibly also inhabit the area, Gonothyraea loveni and Laomedea flexuosa but these were not found together with B. matsmichaeli. The egg mass is in the shape of a narrow whitish spiral cord with about 3 whorls (Fig 2C). The egg mass contains about 250 eggs.

Distribution

To date known only from the internal parts of the Idefjord in the Bohuslän region.

Discussion

The phylogenetic position of Bohuslania

In the present study we, for the first time, report the discovery of a genus that is robustly confirmed as a sister taxon to the genus Cuthona according to our molecular phylogenetic analysis (Fig 1). The combination of the molecular data, external and internal morphological data support the presence of a new nudibranch genus and species Bohuslania matsmichaeli gen. n., sp. n. and allow it to be placed in a broad-scope framework of the nudibranch phylogeny with novel implications for evolution, classification and biogeography of aeolidacean nudibranchs. The discovery of this new taxon considerably strengthens the re-establishment of the family Cuthonidae, since morphologically Bohuslania gen. n. is consistent with the diagnosis of the family Cuthonidae (a broad head with prominent lateral lobes, several rows of digestive glands, a supplementary gland inserted into the base of an unarmed copulative apparatus), but at the same time it possesses own apomorphies (lateral instead of central position of oral tentacles, fewer number of rows of anterior digestive gland, absence of pre-rhinophoral ceratal rows, invariably acleioproctic anus) which clearly distinguishes the genus from the genus Cuthona. In all molecular analyses that were performed in the course of the present study, Bohuslania was always placed as sister taxon to Cuthona. Recently a molecular phylogenetic study [8] controversially suggested that several morphologically very disparate taxa of aeolidacean nudibranchs should be united under the single family Fionidae. Such a decision is problematic since morphologically well supported families form separate molecular clades [7, 9; present study, Fig 1] and the lumping concept of the family Fionidae proposed by Cella et al. [8] lacks support by any morphological synapomorphies. After adding the novel molecular data on Bohuslania, the several distinct clades corresponding to the family groups among the traditional “tergipedids” (to which appropriate morphological apomorphies can be provided) remained stable (Fig 1). This confirms the necessity of the general re-classification of the aeolidacean nudibranchs based on integration of molecular and morphological evidences [7, 9]. Thus, the discovery of the molecularly-proven independent development-driven evolution in two distinct aeolidacean clades contributes to the vast field of habitat shift studies [1518, 25] and to the taxonomy and phylogeny of one of the most intriguing invertebrate groups–the aeolidacean nudibranch molluscs [5, 79, 4351].

Biogeographic pattern of the new nudibranch taxon

Brackish-water adapted invertebrate species commonly demonstrate broad geographical ranges, which are often related to their considerable invasive ability when introduced to similarly brackish areas, such as harbours and rivermouths [52]. There are several brackish water invertebrates which are common in Scandinavian fjords and particularly in the Swedish Idefjord, including cnidarian hydroid polyp Cordylophora caspia (Pallas, 1771), nemertean Cyanophthalma obscura (Schultze, 1851), polychaete Hediste diversicolor (O.F. Müller, 1776), crustaceans Neomysis integer (Leach, 1814), Gammarus zaddachi Sexton, 1912, Gammarus duebeni Lilljeborg, 1852 and Palaemon varians Leach, 1813 [5360] and the bryozoan Einhornia crustulenta (Pallas, 1766) [61]. Some invasive brackish-water species present in the inner part of the Idefjord are the gastropod mollusc Potamopyrgus antipodarum (Gray, 1843) [62] and the polychaete Marenzelleria viridis (Verrill, 1873) [63]. However, all these species from very different phyla have broad distribution at least in Atlantic and Mediterranean regions, and no one has been proved to be an extremely narrow endemic of a Swedish fjord. Sometimes there are rare species with limited distribution, an example is the ditch shrimp Palaemon varians, which along the Swedish coast is only found in a single pond, in which it occurs in large numbers. P. varians is, however, common along the shores of west Europe and its range reaches also the Mediterranean Sea [54]. The case of the geographically very restricted Bohuslania in the Idefjord stands in a strong contrast to this pattern. To date only a single aeolidacean nudibranch–Tenellia adspersa–is known to be a predominantly brackish-water species [26, 64]. However, T. adspersa is a cosmopolitan species and has also been found in waters with normal marine salinity [12, 26]. In addition, two other nudibranch species have been reported sometimes from the estuarine zone, Corambe obscura (Verrill, 1870), and Trinchesia perca (Er. Marcus, 1958); however, these species were only occasionally found in brackish waters, and have very broad distribution ranges including the normal oceanic environment [11]. Thus, Bohuslania is the first true brackish-water nudibranch, which does not occur in waters with salinity higher than 20 ‰, which also has an extremely restricted geographic range. The Idefjord, the only known habitat of the new brackish-water taxon, is a silled fjord. The sills inhibit deepwater exchange and cause prolonged residence times of the water masses, which lead to periods of oxygen depletion [65], but this may also contribute to the isolated position of the newly described new taxon. A similar example is the recent report of a relict population of the arctic nudibranch Dendronotus velifer in the Swedish Gullmar fjord [66].

The nudibranch fauna of the Scandinavian fjords is one of the best studied faunas in the world; however, despite an intensive search in various areas of Norway and Sweden the new genus and species Bohuslania matsmichaeli has been found only within single fjord, the Idefjord, and moreover in some very limited areas of the internal parts of this fjord. Therefore, it is unlikely that such a very restricted distribution of Bohuslania is due to insufficient data from other fjords. Instead, such a unique distribution could imply a particular historical pattern of formation of this species within the larger Scandinavian-Baltic region which has had a very convoluted history of dynamic interaction between marine and freshwater basins.

Brackish water-diversification triggered by paedomorphosis-driven evolution

Paedomorphosis is an important evolutionary driving force [6769], although the importance for taxonomy and phylogenetics may be considerably underestimated [7074]. The present molecular phylogenetic analysis (Figs 1 and 3) shows that the well-known predominantly brackish-water cosmopolitan aeolidacean species Tenellia adspersa and the hereby described exclusively brackish-water living, but very restricted, endemic species Bohuslania matsmichaeli are placed in completely separated phylogenetic clades,and belong to different aeolidacean families; Trinchesiidae and Cuthonidae respectively (Fig 1). The presence of an oral veil instead of the usual oral tentacles within the derived (according to the molecular data in [8]; present study) genus Tenellia s. str. is a clear sign for secondary regaining of this character since the oral veil is a plesiomorphic state for the whole of the Nudibranchia [7]. Because a small oral veil is part of early ontogeny of various non-directly related aeolidaceans [26, 75] and transforms into oral tentacles only in a later developmental stage, it is a very good example of pseudoplesiomorphy caused by paedomorphosis-like ontogenetic shifts [74].

This adds a very special perspective for the present study, since the newly described genus Bohuslania demonstrates several features which are consistent with those found in late juveniles of 5–10 mm length of the species of the sister genus Cuthona, i.e. 3–4 rows of anterior cerata, absence of pre-rhinophoral ceratal rows, less prominent lateral lobes of head [12,76, present study]. Adult mature Cuthona nana may on the contrary have up to 10 anterior ceratal rows, well defined pre-rhinophoral ceratal rows and lateral head expansion [12,76, present study, Fig 4]. Thus, mature specimens of B. matsmichaeli correspond to the late juvenile specimens of C. nana by several characters, and also by body size (length of adult B. matsmichaeli does not exceed 10 mm, whereas adult C. nana may reach 30 mm in length). This could imply that the common ancestor of Cuthona and Bohuslania was more similar to Cuthona in the adult stages, but that in the Bohuslania line a heterochronic process of juvenilization occurred. There is another very interesting implication of the heterochrony-driven speciation in Bohuslania. It was previously specifically concluded [76] that the original description of the type species of the genus, Cuthona, C. nana was originally based on immature specimens. This generated a long-term taxonomic confusion that was finally settled only relatively recently [12, 49]. By the discovery of Bohuslania we thus for the first time have shown the real existence of adult mature specimens of a member of the family Cuthonidae with juvenile features that are morphologically similar to previously discussed immature late juvenile features of C. nana and further confirm this with molecular phylogenetic data. Bohuslania matsmichaeli is proven to be fully mature and able to reproduce at the size no more than 10 mm, which corresponds to the immature stages of C. nana (Fig 4).

The present molecular phylogenetic analysis (Fig 1) as well as a recently published major reassessment of the of the aeolidacean nudibranchs [9] shows that a reduction of the digestive gland branches has occurred in most of the genera of the family Trinchesiidae, and hence also can be connected to developmental-driven heterochronic changes. However, even among the generally more paedomorphic family Trinchesiidae the predominantly brackish-water genus Tenellia s.str. is the only genus in which such an earlier juvenile feature as a secondary oral veil has appeared, instead of oral tentacles (Fig 4). All other genera of the family Trinchesiidae invariably have well defined oral tentacles. In its turn, the newly discovered genus Bohuslania is the only genus of the family Cuthonidae that demonstrates evident persistence of the late juvenile features at adult stages (Fig 4). Thus, Bohuslania has acquired some paedomorphic features in parallel with Tenellia s. str. which belong to different molecular clades and different families (Fig 1). Since Tenellia and Bohuslania are the only predominantly brackish water-associated aeolidacean nudibranchs, this might suggest that brackish water speciation at least in the Nudibranchia can be facilitated by paedomorphosis-related heterochronic shifts in ontogeny. Another potential example of paedomorphic tendencies in the formation of an oral veil-like structure (oral tentacles still present and connected in the middle with a narrow strand, like a semi-oral veil) in “Cuthona” rolleri Behrens & Gosliner, 1988 [77]. This is a species living in a special environment from a geographically very distant location; mud flats in the northeastern Pacific. The combination of external morphology, radular features and details of reproductive system in “Cuthona” rolleri could also imply that it represents a separate genus belonging to the family Cuthonidae or to some related basal families. A species with somewhat juvenile morphology, “Precuthona” chrysanthema Roginskaya, 1987 was described from the White Sea [78] and was subsequently synonymized with Cuthona nana [79]. However, in the first description of “P.” chrysanthema the large, irregularly placed convex white spots on the cerata and yellow digestive gland were specially noted [78]. These characters correspond to a single White Sea species, Zelentia pustulata, according to the most recent data [7]. Cuthona nana and Bohuslania matsmichaeli never possess any big white spots on the cerata (Fig 4). On the other hand, for“P.” chrysanthema an absence of penial stylet was also mentioned [78], which is characteristic for the family Cuthonidae and not for Trinchesiidae, including Zelentia [7]. The putative absence of the stylet, even from a very small specimen [78], was a reason for synonymy of the latter species with C. nana in [79]. In the light of the considerable external similarity of “P.” chrysanthema to Z. pustulata and not to C. nana we therefore propose here that presence of penial stylet was not recognized for “P.” chrysanthema in [78].“P.” chrysanthema is thus considered as a synonym of Zelentia pustulata (= “P.” chrysanthema syn. n.). “P.” chrysanthema most likely represents a juvenile of Z. pustulata and not C. nana.

There are also additional interesting features that unite the phylogenetically unrelated, but both heterochrony-driven, genera Tenellia and Bohuslania. Both T. adspersa and B. matsmichaeli share a brownish to blackish coloration (Figs 2 and 4) in strong contrast with commonly colourful North Atlantic aeolidacean nudibranchs from areas with normal oceanic salinity. This feature needs additional investigation but together with other reduced paedomorphosis-related characters of Tenellia and Bohuslania could be related to the variability of the available nutrient content of the brackish water environment and also to the osmotic stress, that might cause the delay of development of certain characters (that was showed for example for the blue mussel Mytilus edulis in the Baltic Sea [80]) and indirectly produce some adaptations of these taxa to this specific niche.

When considering the paedomorphosis-driven external features, Tenellia and Bohuslania could be erroneously assessed as closely related taxa, but the present molecular analysis (Fig 1) as well as internal morphological data clearly suggest that these genera belong to different aeolidacean families (Figs 1 and 3). This is to date the first evident case of a parallel brackish-water phylogenetic diversification driven by developmental heterochronic changes.

Acknowledgments

We thank Mats Larsson and Michael Lundin for discovering and providing specimens of the new species, also thanks to Mats Larsson, Michael Lundin and Fredrik Pleijel for photos. KL wishes to thank Dr. Björn Källström at the Gothenburg maritime museum and aquarium for the use of their DNA lab, and Dr. Arne Nygren for invaluable advice. Dr. Svante Martinsson at the Gothenburg University most helpfully assisted with barcode gap analysis of the specimens sequenced in Sweden. Karin Fletcher (Port Orchard, USA) is warmly thanked for photographs of Cuthona divae. We thank the team of the Gulen Dive Resort (Christian Skauge, Ørjan Sandnes, Monica Bakkeli and Guido Schmitz) for their generous help during fieldwork in Norway and A.G. Bogdanov and G.N. Davidovich (Electron Microscopy Laboratory MSU) for support with electron microscopy. Shuhei Nomura (National Museum of Nature and Science, Tsukuba) is thanked for introducing NanoSuit non-destructive SEM study method. Toshihiko Fujita (National Museum of Nature and Science, Tsukuba) is specially thanked for organizing the research stay of AM and TK in the above-mentioned museum. This study was supported by a research project of MSU Zoological Museum (AAAA-A16-116021660077-3, depository of specimens), The Russian Science Foundation (grant 14-50-00029, collecting of specimens, morphological & molecular study), and the Russian Foundation for Basic Research grant # 17-04-01827 А. Finally, we would like to thank reviewers who suggested improvements to this paper.

Data Availability

All relevant data are within the paper.

Funding Statement

This study was supported by research project of Moscow State University Zoological Museum (AAAA-A16-116021660077-3, depository of specimens), the Russian Foundation for Basic Research grant # 17-04-01827 А, and The Russian Science Foundation (grant 14-50-00029, collecting of specimens, morphological & molecular study), http://rscf.ru/en.

References

  • 1.Wägele H, Klussmann-Kolb A, Verbeek E, Schrödl M. Flashback and foreshadowing–a review of the taxon Opisthobranchia. Org Diver Evol. 2014; 14: 133–149. doi: 10.1007/s13127-013-0151-5 [Google Scholar]
  • 2.Newcomb JM., Sakurai A, Lillvis JL, Gunaratne CA, Katz PS. Homology and homoplasy of swimming behaviors and neural circuits in the Nudipleura (Mollusca, Gastropoda, Opisthobranchia). PNAS. 2012; 109: 10669–10676. doi: 10.1073/pnas.1201877109 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Blunt JW, Copp BR, Keyzers RA., Munro MH, Prinsep MR. Marine natural products. Nat Prod Rep. 2015; 32: 116–211. doi: 10.1039/c4np00144c . [DOI] [PubMed] [Google Scholar]
  • 4.Lindsay T, Valdés Á. The model organism Hermissenda crassicornis (Gastropoda: Heterobranchia) is a species complex. PLoSOne. 2016; 11: e0154265 doi: 10.1371/journal.pone.0154265 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Carmona L, Pola M, Gosliner TM, Cervera JL. A tale that morphology fails to tell: A molecular phylogeny of Aeolidiidae (Aeolidida, Nudibranchia, Gastropoda). PLoSOne. 2013; 8: e63000 doi: 10.1371/journal.pone.0063000 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Goodheart JA. Insights into the systematics, phylogeny, and evolution of Cladobranchia (Gastropoda: Heterobranchia). Amer Malac Bull. 2017; 35: 73–81. doi: 10.4003/006.035.0111 [Google Scholar]
  • 7.Korshunova T, Martynov A, Picton B. Ontogeny as an important part of integrative taxonomy in tergipedid aeolidaceans (Gastropoda: Nudibranchia) with a description of a new genus and species from the Barents Sea. Zootaxa. 2017; 4324: 1–022. doi: 10.11646/zootaxa.0000.0.0 [Google Scholar]
  • 8.Cella K, Carmona L, Ekimova I, Chichvarkhin A, Schepetov D, Gosliner TM. A Radical Solution: The phylogeny of the nudibranch family Fionidae. PLoSOne. 2016; 11: e0167800 doi: 10.1371/journal.pone.0167800 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Korshunova T, Martynov A, Bakken T, Evertsen J, Fletcher K, Mudianta WI et al. Polyphyly of the traditional family Flabellinidae affects a major group of Nudibranchia: aeolidacean taxonomic reassessment with descriptions of several new families, genera, and species (Mollusca, Gastropoda). ZooKeys 2017; 717: 1–139. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Evertsen J, Bakken T, Green S. Rediscovery of Tenellia adspersa (Nudibranchia) from the Finnish archipelago. Sarsia. 2004; 89: 362–365. doi: 10.1080/00364820410002569 [Google Scholar]
  • 11.Martynov AV, Korshunova TA, Grintsov VA. Opisthobranch molluscs of the Northern Black Sea. I. Short history of studies and the first record of a non-indigenous nudibranch species Trinchesia perca (Er. Marcus, 1958) (Nudibranchia: Tergipedidae). Ruthenica. 2007; 17: 43–54. [Google Scholar]
  • 12.Thompson TE, Brown GH. Biology of Opisthobranch Molluscs, Vol. 2. London: The Ray Society Publications, 1984. [Google Scholar]
  • 13.Neusser TP, Fukuda H, Jörger KM, Kano M, Schrödl M. Sacoglossa or Acochlidia? 3D reconstruction, molecular phylogeny and evolution of Aitengidae (Gastropoda: Heterobranchia). Journal of Molluscan Studies. 2011; 77 (4): 332–350. doi: 10.1093/mollus/eyr033 [Google Scholar]
  • 14.Kano Y, Brenzinger B, Nützel A, Wilson N G, Schrödl M. Ringiculid bubble snails recovered as the sister group to sea slugs (Nudipleura). Scientific reports. 2016; 6: 30908 doi: 10.1038/srep30908 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Forrestel EF, Ackerly DD, Emery NC. The joint evolution of traits and habitat: ontogenetic shifts in leaf morphology and wetland specialization in Lasthenia. New Phytol. 2017; 208: 949–959. doi: 10.1111/nph.13478 [DOI] [PubMed] [Google Scholar]
  • 16.Roxio FF, Lujan NK, Tagliacollo VA, Waltz BT, Silva GSC, Oliveira C et al. Shift from slow- to fast-water habitats accelerates lineage and phenotype evolution in a clade of Neotropical suckermouth catfishes (Loricariidae: Hypoptopomatinae). PLoSOne. 2017; 12: e0178240 doi: 10.1371/journal.pone.0178240 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Schoener TW. Competition and the form of habitat shift. Theor Popul Biol. 1974; 6: 265–307. [DOI] [PubMed] [Google Scholar]
  • 18.Vitt LJ, Caldwell JP, Zani PA, Titus TA. The role of habitat shift in the evolution of lizard morphology: evidence from tropical Tropidurus. PNAS. 1997; 94: 3828–3832. PMCID: PMC20526 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Cognetti G, Maltagliati F. Biodiversity and adaptive mechanisms in brackish water fauna. Mar Poll Bull. 2000; 40: 7–14. doi: 10.1016/S0025-326X(99)00173-3 [Google Scholar]
  • 20.Delicado D, Machordom A, Ramos MA. Effects of habitat transition on the evolutionary patterns of the microgastropod genus Pseudamnicola (Mollusca, Hydrobiidae). Zool Scripta. 2015; 44: 403–417. doi: 10.1111/zsc.12104 [Google Scholar]
  • 21.Bilton DT, Paula J, Bishop JDD. Dispersal, genetic differentiation and speciation in estuarine organisms. Estuar Coast Shelf Scie. 2015; 55: 937–952. doi: 10.1006/ecss.2002.1037 [Google Scholar]
  • 22.Whitfield AK, Elliott M, Basset A. Blaber SJM, West RJ. Paradigms in estuarine ecology: A review of the Remane diagram with a suggested revised model for estuaries. Estuar Coast Shelf Scie. 2012; 97: 78–90. doi: 10.1016/j.ecss.2011.11.026 [Google Scholar]
  • 23.Ashelby CW, Page TJ, De Grave S, Hughes JM, Johnson ML. Regional scale speciation reveals multiple invasions of freshwater in Palaemoninae (Decapoda). Zool Scripta. 2012; 41: 293–306. doi: 10.1111/j.1463-6409.2012.00535.x [Google Scholar]
  • 24.Boeger WA, Marteleto FM, Zagonel L, Braga MP. Tracking the history of an invasion: the freshwater croakers (Teleostei: Sciaenidae) in South America. Zool Scripta. 2015; 44: 250–262. doi: 10.1111/zsc.12098 [Google Scholar]
  • 25.Jörger KM, Brenzinger B, Neusser TP, Martynov AV, Nerida G. Wilson et al. Panpulmonate habitat transitions: tracing the evolution of Acochlidia (Heterobranchia, Gastropoda). Bioarxiv. 2014; https://doi.org/10.1101/010322 [Google Scholar]
  • 26.Eyster LS. Reproduction and developmental variability in the opisthobranch Tenellia pallida. Mar. Biol. 1979; 51: 133–140. doi: 10.1007/BF00555192 [Google Scholar]
  • 27.Neusser TP, Schrödl M. Between Vanuatu tides: 3D anatomical reconstruction of a new brackish water acochlidian gastropod from Espiritu Santo. Zoosystema. 2009; 31: 453–469. doi: 10.5252/z2009n3a4 [Google Scholar]
  • 28.Stenström A. Marinbiologisk undersökning i de inre delarna av Idefjorden 2010. The County Administrative Board of Västra Götaland, report 2010–65, 2010.
  • 29.Hariyama T, Takaku Y. Dressing living organisms in the NanoSuit® for FE-SEM observation. JEOL NEWS. 2015; 50: 26–37. [Google Scholar]
  • 30.Takaku Y, Suzuki H, Ohta I, Tsutsui T, Matsumoto H, Shimomura M, et al. 'NanoSuit' surface shield successfully protects organisms in high vacuum: observations on living organisms in an FE-SEM. Proc Biol Sci. 2015; 282: 20142857 doi: 10.1098/rspb.2014.2857 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Martynov AV, Sanamyan NP, Korshunova TA. New data on the opisthobranch molluscs (Gastropoda: Opisthobranchia) of waters of Commander Islands and Far-Eastern seas of Russia. Conservation of biodiversity of Kamchatka and coastal waters. Proceedings of XV international scientific conference Petropavlovsk-Kamchatsky. Kamchat Press, Petropavlovsk-Kamchatsky, 2015.
  • 32.Martynov AV, Sanamyan NP, Korshunova TA. Review of the opisthobranch mollusc fauna of Russian Far Eastern seas: Pleurobranchomorpha, Doridida and Nudibranchia. Bull Kamch State Techn Univ. 2015; 34: 62–87. doi: 10.17217/2079-0333-2015-34-62-87 [Google Scholar]
  • 33.Chichvarkhin AY, Ekimova I, Egorova E, Chichvarkhina OV. Species identity of a nudibranch mollusk of the genus Cuthona associated with hermit crabs in the sea of Japan. 2016; Biol Morya; 42: 449–457. [Google Scholar]
  • 34.Edgar RC. MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004; 32: 1792–1797. doi: 10.1093/nar/gkh340 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Talavera G, Castresana J. Improvement of phylogenies after removing divergent and ambiguosly aligned blocks from protein sequence alignments. Syst. Biol. 2007; 56: 564–577. doi: 10.1080/10635150701472164 [DOI] [PubMed] [Google Scholar]
  • 36.Nylander JA, Ronquist F, Huelsenbeck JP, Nieves-Aldrey JL. Bayesian phylogenetic analysis of combined data. Syst Biol. 2004; 53: 47–67. [DOI] [PubMed] [Google Scholar]
  • 37.Akaike H. A new look at the statistical model identification. IEEE Trans Automat Control. 1974; 19: 716–723. doi: 10.1007/978-1-4612-1694-0_16 [Google Scholar]
  • 38.Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S et al. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012; 61: 539–542. doi: 10.1093/sysbio/sys029 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Stamatakis A, Hoover P, Rougemont J. A Rapid bootstrap algorithm for the RAxML web-servers. Syst. Biol. 2008; 75: 758–771. doi: 10.1080/10635150802429642 [DOI] [PubMed] [Google Scholar]
  • 40.Kumar S, Stecher G, Tamura K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol. 2016; 33: 1870–1874. doi: 10.1093/molbev/msw054 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Puillandre N, Lambert A, Brouillet S, Achaz G. ABGD, Automatic barcode gap discovery for primary species delimitation. Mol Ecol. 2012; 21: 1864–1877. doi: 10.1111/j.1365-294X.2011.05239.x [DOI] [PubMed] [Google Scholar]
  • 42.Dayrat B. Towards integrative taxonomy. Biol J Linn Soc. 2005; 85, 407–415. doi: 10.1111/j.1095-8312.2005.00503.x [Google Scholar]
  • 43.Carmona L, Pola M, Gosliner TM, Cervera JL. The Atlantic-Mediterranean genus Berghia Trinchese, 1877 (Nudibranchia: Aeolidiidae): taxonomic review and phylogenetic analysis. J Moll Stud. 2014; 80: 482–498. doi: 10.1093/mollus/eyu031 [Google Scholar]
  • 44.Kienberger K, Carmona L, Pola M, Padula V, Gosliner TM, Cervera JL. Aeolidia papillosa (Linnaeus, 1761) (Mollusca: Heterobranchia: Nudibranchia), single species or a cryptic species complex? A morphological and molecular study. Zool J Linn Soc. 2016; 177: 481–506. doi: 10.1111/zoj.12379 [Google Scholar]
  • 45.Korshunova T, Zimina O, Martynov A. Unique pleuroproctic taxa of the nudibranch family Aeolidiidae from the Atlantic and Pacific Oceans, with description of a new genus and species. J Moll Stud. 2017. doi: 10.1093/mollus/eyx036 [Google Scholar]
  • 46.Martin R, Heß M, Schrödl M, Tomaschko KH. Cnidosac morphology in dendronotacean and aeolidacean nudibranch molluscs: from expulsion of nematocysts to use in defense? Mar Biol. 2009; 156: 261–268. doi: 10.1007/s00227-008-1080-2 [Google Scholar]
  • 47.Martin R, Tomaschko KH, Heß M, Schrödl M. Cnidosac-related structures in Embletonia (Mollusca, Nudibranchia) compared with Dendronotacean and Aeolidacean species. Open Mar Biol J. 2010; 4: 96–100. doi: 10.2174/1874450801004010096 [Google Scholar]
  • 48.Martynov AV. A new species of nudibranch molluscs of the Sea of Japan with notes on the genus Cuthonella (Gastropoda, Opisthobranchia). Zool Zhurn. 1992; 71: 18–24. [Google Scholar]
  • 49.Martynov AV. Two new species of the genus Trinchesia Ihering, 1879 from Peter the Great Bay, Japan Sea (Nudibranchia, Tergipedidae), with notes on the taxonomy of the family. Ruthenica. 2002; 12: 45–54. [Google Scholar]
  • 50.Miller MC. An appraisal of the identity of the New Zealand species of the aeolid nudibranch family Tergipedidae (Gastropoda: Opisthobranchia). J Nat Hist. 2004; 38: 1183–1192. doi: 10.1080/0022293031000077699 [Google Scholar]
  • 51.Miller MC, Willan RC. A redescription and taxonomic reappraisal of the Indo-Pacific aeolid nudibranch Trinchesia sibogae (Bergh, 1905) (Gastropoda, Opisthobranchia). Vita Malacologica. 2005; 3: 69–75. [Google Scholar]
  • 52.Bonsdorff E. Zoobenthic diversity-gradients in the Baltic Sea: Continuous post-glacial succession in a stressed ecosystem. J Exp Mar Biol Ecol. 2006; 330: 383–391. doi: 10.1016/j.jembe.2005.12.041 [Google Scholar]
  • 53.Baltazar-Soares M, Paiva F, Chen Y, Zhan A. Diversity and distribution of genetic variation in gammarids: Comparing patterns between invasive and non-invasive species. Ecol Evol. 2017; 1–12. doi: 10.1002/ece3.3208 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Dolmen D, Hindley JD, Kleiven E. Distribution of Palaemonetes varians (Leach) (Crustacea, Decapoda) in relation to biotope and other caridean shrimps in brackish waters of southern Norway and southwestern Sweden. Sarsia. 2004; 89: 8–21. doi: 10.1080/00364820310003244 [Google Scholar]
  • 55.Norenburg J. Redescription of a brooding nemertine, Cyanophthalma obscura (Schultze) gen. et. comb.n., with observations on its biology and discussion of the species of Prostomatella and related taxa. Zool. Scripta. 1986; 15: 227–293. doi: 10.1111/j.1463-6409.1986.tb00229.x [Google Scholar]
  • 56.Scaps P. A review of the biology, ecology and potential use of the common ragworm Hediste diversicolor (O.F. Müller) (Annelida: Polychaeta). Hydrobiologia. 2002; 470, 203–218. doi: 10.1023/A:1015681605656 [Google Scholar]
  • 57.Meek MH, Wintzer AP, Wetzel WC, May B. Climate change likely to facilitate the invasion of the non-native hydroid, Cordylophora caspia, in the San Francisco Estuary. PLoSONE. 2012; 7: e46373 doi: 10.1371/journal.pone.0046373 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Mees J, Abdulkerim Z, Hamerlynck O. Life history, growth and production of Neomysis integer in the Westerschelde estuary (SW Netherlands). Mar Ecol Progr Ser. 1994; 109: 43–57. doi: 10.3354/meps109043 [Google Scholar]
  • 59.Smith DG, Smith SF, Werle E, Klekowski SF. The rapid colonization and emerging biology of Cordylophora caspia (Pallas, 1771) (Cnidaria: Clavidae) in the Connecticut River. J Freshw Ecol. 2002; 17: 423–430. [Google Scholar]
  • 60.Steele DH, Steele VJ. The biology of Gammarus (Crustacea, Amphipoda) in the northwestern Atlantic. I. Gammarus duebeni Lillj. Canad J Zool. 1969; 47: 235–244. doi: 10.1139/z69-050 [Google Scholar]
  • 61.Grabowska M., Kukliński P. Spatial pattern of hydrolittoral rock encrusting assemblages along the salinity gradient of the Baltic Sea. Hydrobiologia. 2016; 765: 297–315. doi: 10.1007/s10750-015-2421-z [Google Scholar]
  • 62.Carlsson R. The distribution of the gastropods Theodoxus fluviatilis (L.) and Potamopyrgus antipodarum (Gray) in lakes on the Aland Islands, southwestern Finland. Boreal environment research. 2000; 5: 187–195. [Google Scholar]
  • 63.Zettler ML, Bick A, Bochert R. Distribution and population dynamics of Marenzelleria viridis (Polychaeta, Spionidae) in a coastal water of the southern Baltic. Arch Fishery Mar Res. 1995; 42: 209–224. [Google Scholar]
  • 64.Roginskaya IS. Tenellia adspersa, a nudibranch new to the Azov Sea, with notes on its taxonomy and ecology. Malacol Rev. 1970; 3: 167–174. [Google Scholar]
  • 65.Davidsson S, Martinsson S, Gomes W. The Recovery- pollution and chronology in the Idefjord located on the Swedish west coast, on the border between Sweden and Norway. Göteborg: Department of Earth sciences, University of Gothenburg; C115, 2015. [Google Scholar]
  • 66.Lundin K, Korshunova T, Malmberg K, Martynov A. Intersection of historical museum collections and modern systematics: a relict population of the Arctic nudibranch Dendronotus velifer G.O. Sars, 1878 in a Swedish fjord. Contr Zool. 2017; 86: 303–318. [Google Scholar]
  • 67.Bhullar BA, Marugán-Lobón J, Racimo F, Bever GS, Rowe TB, Norell MA, et al. Birds have paedomorphic dinosaur skulls. Nature. 2012; 487: 223–226. doi: 10.1038/nature11146 [DOI] [PubMed] [Google Scholar]
  • 68.Härer AH, Torres-Dowdall J, Meyer A. Rapid adaptation to a novel light environment: the importance of ontogeny and phenotypic plasticity in shaping the visual system of Nicaraguan Midas cichlid fish (Amphilophus citrinellus spp.). Mol Ecol. 2017. doi: 10.1111/mec.14289 [DOI] [PubMed] [Google Scholar]
  • 69.Martynov A, Schrödl M. Phylogeny and evolution of corambid nudibranchs (Mollusca: Gastropoda). Zool J Linn Soc. 2011; 163: 585–604. doi: 10.1111/j.1096-3642.2011.00720.x [Google Scholar]
  • 70.Kerbl A, Fofanova EG, Mayorova TD, Voronezhskaya EE, Worsaae K. Comparison of neuromuscular development in two dinophilid species (Annelida) suggests progenetic origin of Dinophilus gyrociliatus. Front Zool. 2016; 13: 49 doi: 10.1186/s12983-016-0181-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Oromi N, Michaux J, Denoël M. High gene flow between alternative morphs and the evolutionary persistence of facultative paedomorphosis. Sci. Rep. 2016; 6: 32046 doi: 10.1038/srep32046 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Bocak L, Kundata R, Andujar Fernandez C, Vogler AP. The discovery of Iberobaeniidae (Coleoptera: Elateroidea): a new family of beetles from Spain, with immatures detected by environmental DNA sequencing. Proceedings of the Royal Society B. 2016; 283: 20152350 doi: 10.1098/rspb.2015.2350 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Barfod AS. Letter to the twenty-first century botanist–what is a flower? 4. Heterochrony–still an overlooked source of rapid morphological change in flowers? Bot Lett. 2017; 164: 105–109. doi: 10.1080/23818107.2017.1314830 [Google Scholar]
  • 74.Stöhr S, Martynov A. Paedomorphosis as an evolutionary driving force: Insights from Deep-Sea brittle stars. PLoSOnE. 2016. 11: e0164562 doi: 10.1371/journal.pone.0164562 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Tardy JP. Contribution a l'étude des métamorphoses chez les nudibranches. Ann Sci Naturel. 1970; 12: 299–370. [Google Scholar]
  • 76.Brown GH. The British species of the aeolidacean family Tergipedidae (Gastropoda: Opisthobranchia) with a discussion of the genera. Zool J Linn Soc. 1980; 69: 225–255. doi: 10.1111/j.1096-3642.1980.tb01124.x [Google Scholar]
  • 77.Behrens DW, Gosliner TM. A new species of tergipedid nudibranch from Morro Bay, California. The Veliger. 1988; 31: 262–266. [Google Scholar]
  • 78.Roginskaya IS. Order Nudibranchia Blainville, 1814 In: Molluscs of the White Sea. Keys to Fauna of SSSR, ZIN AN SSSR, 1987. [Google Scholar]
  • 79.Martynov AV. Nudipleura. In: Kantor Yu.I., Sysoev A.V. (Eds.), Marine and brackish water Gastropoda of Russia and adjacent countries: an illustrated catalogue. Moscow: KMK Scientific Press Ltd, 2006. [Google Scholar]
  • 80.Westerbom M., Kilpi M., Mustonen O. Blue mussels, Mytilus edulis, at the edge of the range: population structure, growth and biomass along a salinity gradient in the north-eastern Baltic Sea. Mar Biol, 2002; 140: 991–999. [Google Scholar]
  • 81.Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Mar Biol Biotech. 1994; 3: 294–299. [PubMed] [Google Scholar]
  • 82.Palumbi SR, Martin AP, Romano S, McMillan WO, Stice L, Grabowski G. The simple fool’s guide to PCR. Honolulu: University of Hawaii, 2002. [Google Scholar]
  • 83.Puslednik L, Serb JM. Molecular phylogenetics of the Pectinidae (Mollusca: Bivalvia) and effect of increased taxon sampling and outgroup selection on tree topology. Mol Phyl Evol. 2008; 48: 1178–1188. doi: 10.1016/j.ympev.2008.05.006 [DOI] [PubMed] [Google Scholar]
  • 84.Colgan D, Macaranas J, Cassis G, Gray MR. Histone H3 and U2 snRNA DNA sequences and arthropod molecular evolution. Austr J Zool. 1998; 4: 419–437. [Google Scholar]
  • 85.Dayrat B, Tillier A, Lecointre G, Tillier S. New clades of euthyneuran gastropods (Mollusca) from 28S rRNA sequences. Mol Phyl Evol. 2001; 19: 225–235. [DOI] [PubMed] [Google Scholar]
  • 86.Le HLV, Lecointre G, Perasso R. A 28S rRNA based phylogeny of the Gnathostomes: First steps in the analysis of conflict and congruence with morphologically based cladograms. Mol Phyl Evol, 1993; 2: 31–51. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All relevant data are within the paper.


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES